175,069 results
-
Plasmid#64402PurposeUbiquitin promoter driving synthetic optimised GUSPlus gene. Can be used as a reporter of promoter activity in plants by replacing Ubi promoter with sequence of interest.DepositorInsertubiquitin (Ubi-1) promoter
TagsGUSPlus reporterExpressionPlantPromoterUbi-1Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC3-hGli3
Plasmid#65435PurposeExpresses human Gli3 protein in mammalian cellsDepositorAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSaGuide
Plasmid#64710PurposeCloning and expression of Staphylococcus aureus guide RNADepositorInsertStaphylococcus aureus guide RNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-tdTomato-CNA35
Plasmid#61606Purposebacterial expression of N-terminal fusion protein of CNA35 with tdTomatoDepositorInserttdTomato and CNA35
TagsHis tagExpressionBacterialPromoterT7Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-ICUE3
Plasmid#61623PurposePlasma membrane-targeted FRET biosensor for monitoring cAMPDepositorInsertLyn-ICUE3 (RAPGEF3 Human)
TagsECFP, N-terminal targeting sequence from Lyn kina…ExpressionMammalianPromoterCMVAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSIN4-EF1a-TAL1-IRES-Puro
Plasmid#61065Purposelentiviral vector for TAL1DepositorAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
Spectrin-M-cpstFRET
Plasmid#61109PurposeExpression of Spectrin-cpstFRET to measure mechanical stress and report multidimensional stress fieldsDepositorInsertspectrin-cpstFRET
ExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only