We narrowed to 6,879 results for: crispr cas9 plasmids
-
Plasmid#65597Purposeco-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 geneDepositorInsertsgRNA for APs12
UseCRISPRExpressionWormPromoterU6Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTetO-hOSK-CASH-1
Plasmid#188977PurposeA CASH-1 GSH targeting, doxycycling inducible humanized Oct4, Sox2, and Klf4 expressing CRISPR/Cas9 donor plasmid.DepositorInsertDoxycycline inducible reprogramming donor cassette
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBLO1811_arC9_noNLS_human
Plasmid#74494PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/o NLS and a sgRNADepositorInsertarC9
UseCRISPRTagst2a mCherry (C-terminal on insert)ExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV51
Plasmid#179915PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRG (Lenti_sgRNA_EFS_GFP)
Plasmid#65656PurposeLentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter-driven sgRNA expression and EFS promo…Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat
Plasmid#232097PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with NatMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan
Plasmid#232099PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with KanMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS272
Plasmid#73728PurposeSapTrap syntron-embedded FLP-on C-terminal connector donor plasmidDepositorInsertsyntron embedded C-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS281
Plasmid#73732PurposeSapTrap syntron-embedded FLP-on N-terminal connector donor plasmidDepositorInsertsyntron embedded N-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458M-53BP1-DN1S
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTRm
Plasmid#127197PurposepGTRm is the template plasmid for PCR & golden gate assembly driven generation of polycistronic tRNA-gRNA sequencesDepositorInserttRNA-gRNA PCR template
UseTemplate plasmid for generation of golden gate pc…PromoterNoneAvailable SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-Cherry-sgRNA
Plasmid#221387Purposeepisomal (HygR), with constitutive mCherry (Psmyc) and AHT-inducible sgRNA cloning site, including Golden Gate for multiple sgRNAsDepositorInsertnone, cloning vector for introduction of targeting sequences
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only