We narrowed to 15,905 results for: grna
-
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-EGFP_start_codon
Plasmid#233613PurposeExpression of guide RNA targeting the start codon of the EGFP gene for PspCas13bDepositorInsertgRNA targeting EGFP
UseCRISPRAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Tubb3-GFP KI
Plasmid#183432PurposeCreOFF knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb4-GFP KI
Plasmid#139663PurposeEndogenous tagging of CaVβ4: C-terminal (amino acid position: H417)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable sinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2112
Plasmid#91064PurposeModule B, Promoter: PvUbi1, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterPvUbi1Available sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-control
Plasmid#216857PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing transcript at the synapse. CIRTS-YTHDF2-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-Itga5 gRNA
Plasmid#246573PurposeCRISPR vector co-expressing Cas9 and a mouse Itga5 gRNADepositorAvailable sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Cd109 gRNA
Plasmid#246571PurposeCRISPR vector co-expressing Cas9 and a mouse Cd109 gRNADepositorAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_all-in-one_Bip gRNA1
Plasmid#183696PurposeExpresses gRNA targeting chinise hamster Bip (Hspa5) with CRISPRa components and mCherry, blasticidin selectiveDepositorInsertgRNA targeting chinese hamster Bip (Hspa5)
UseCRISPRAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-1gRNA
Plasmid#183912PurposegRNA-expressing plasmid under Aedes aegypti AAEL017702 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017702)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-2gRNA
Plasmid#183913PurposegRNA-expressing plasmid under Aedres aegypti AAEL017774 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017774)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXL002-ishRNA-beta-catenin-1
Plasmid#36297DepositorInsertshRNA of beta-catenin-1 (CTNNB1 Human)
UseLentiviral and RNAiTagsIRES-RFP-PuroExpressionMammalianPromoterTetO-H1Available sinceAug. 7, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSMP-EZH2_1
Plasmid#36387DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g7
Plasmid#80790PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 7/17/27 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g6
Plasmid#80789PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 6/16/26 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only