We narrowed to 13,106 results for: BASE

#188386

Lentiviral vector - tBFP reporter for Gal4-based SNIPRs with a constitutive mCitrine;

Kole Roybal

Zhu et al Cell. 2022 Apr 14;185(8):1431-1443.e16.

March 9, 2023

Academic Institutions and Nonprofits only

#122963

mCherry-based fluorescent reporter for Cre-loxP DNA recombination reaction

Moritoshi Sato

Kawano et al Nat Chem Biol. 2016 Dec;12(12):1059-1064

March 26, 2019

Academic Institutions and Nonprofits only

#122028

Plasmid for expression of gene of interest in Lactobacillus plantarum and L. sakei

Lars Axelsson, Geir Mathiesen

Sorvig et al Microbiology. 2005 Jul;151(Pt 7):2439-49

March 21, 2019

Academic Institutions and Nonprofits only

#187890

CRISPR/Cpf1-based Staphylococcus aureus temperature-sensitive plasmid for genome editing in Staphylococcus aureus

Quanjiang Ji

Wang et al ACS Synth Biol. 2022 Sep 16;11(9):3049-3

Aug. 29, 2022

Academic Institutions and Nonprofits only

#122030

Plasmid for heterologous protein secretion in Lactobacillus plantarum and L. sakei

Vincent Eijsink, Geir Mathiesen

Mathiesen et al BMC Genomics. 2009 Sep 10;10:425. doi: 1

Nov. 11, 2019

Academic Institutions and Nonprofits only

#173481

An rrnB P1-based GFP ATP reporter in E. coli

Rahul Sarpeshkar

Deng et al BMC Biol. 2021 May 17;19(1):101. doi: 10

Aug. 11, 2021

Academic Institutions and Nonprofits only

#207093

pX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

April 30, 2025

Academic Institutions and Nonprofits only

#67547

EasyClone system-based yeast integrative vector carrying loxP-flanked kanMX marker, integration into S. cerevisiae XI-2 chromosomal location, USER site for cloning, amp resistance

Irina Borodina

Stovicek et al J Ind Microbiol Biotechnol. 2015 Sep 16.

March 10, 2016

Academic Institutions and Nonprofits only

#100027

A BRET based CyOFP-teLuc-CyOFP fusion to further red-shift bioluminescence

Huiwang Ai

Yeh et al Nat Methods. 2017 Sep 4. doi: 10.1038/nm

Oct. 13, 2017

Academic Institutions and Nonprofits only

#107336

Red fluorescent glutamate sensor with ncp topology. Membrane-displayed

Robert Campbell

Wu et al ACS Chem Biol. 2018 Jan 22. doi: 10.1021

May 3, 2018

Academic Institutions and Nonprofits only