Addgene

We narrowed to 221 results for: Rras;

Showing: 201 - 220 of 221 results

Results per page:

Viral Vectors 101: Optogenetic Tools

Type

Blog Post

.../doi.org/10.1073/pnas.1936192100 Tichy, A.-M., Gerrard, E. J., Sexton, P. M., & Janovjak, H. (2019). Light-activated...
Antibodies 101: Multiplex Immunofluorescence

Type

Blog Post

...Dumitras, C., Gong, B., Nguyen, K., Van Der List, D., Murray, K. D., Engebrecht, J., & Trimmer, J. S. (2019)...
Technique: Probe Phage Genomes for Host Binding Proteins

Type

Blog Post

...firmly onto each to remove cell debris. Then, UV-irradiate the membranes for 15 min to kill any remaining...
Generating Mouse Models Using CRISPR/Cas9

Type

Blog Post

..., Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex Genome Engineering...
PiggyBac-ing Through the Genome Editing Field

Type

Blog Post

...s chromatin structure undergoes significant rearrangement (such as when a stem cell initiates differentiation...
Finding Your Perfect Job After University

Type

Blog Post

...project to validate some genomic changes, so this arrangement was ideal for everyone. The cutting edge science...
Building Global Connections with the International Mentorship Program USA-EUROPE

Type

Blog Post

...University Miguel de Cervantes, the University of Navarra, and the University of the Basque Country. Mentees...
Luciferase Plasmid Collection

Type

Collection

...promoter is present for normalization Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion...
Important Considerations When Using AAVs

Type

Blog Post

...therapy 8.16 (2001): 1248. PubMed PMID: 11509958. 8. Ferrari, Forrest K., et al. "Second-strand synthesis is...
Custom CRISPR Screens & the Green Listed Software

Type

Blog Post

...the Output_Short file directly. We have used CustomArray, Inc for this purpose. The gRNA oligos are...
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

Type

Blog Post

...for error-free knock-in at both alleles may be warranted (20-30% of all tagged clones were bi-allelic in...
Plasmids 101: Modular Cloning Applications and Kits

Type

Blog Post

...perfect combination. The EcoFlex Kit has a wide array of DNA parts that can be assembled into individual...
Special Delivery: Fluorophore Targeting for FRET Studies

Type

Blog Post

...100 Å). Researchers have developed an extensive array of chemical labeling strategies suitable for targeting...
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation

Type

Blog Post

...to iPSCs and re-establishment after Partial rearrangement from one cell type to another Time and resources...
A Needle in a Base-Stack: Cas9 Structural Biology

Type

Blog Post

...Cas9 grips nucleotides 1-10 of the guide RNA, prearranged for base pairing with a complementary DNA strand...
Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

Type

Blog Post

...academia as well as the non-profit sector are transferrable to industry such as technology transfer, communications...
Antibody Validation for Flow Cytometry

Type

Blog Post

... Bolivar, S. G., Ruiz Moleon, V., Eckmann, P., Worrall, D., McDowell, I., Southern, K., Reintsch, W., ...
Validated gRNA Sequences

Type

Collection

...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285...
Optogenetics + CRISPR, Using Light to Control Genome Editing

Type

Blog Post

... K866PCK mutant was indeed inactive prior to irradiation with UV light (365nm) and that post-UV exposure...
CRISPR 101: Cytosine and Adenine Base Editors

Type

Blog Post

... A., Gehrke, J. M., Lee, S.-J., Liquori, A. J., Murray, R., Packer, M. S., Rinaldi, C., Slaymaker, I. ...

Showing: 201 - 220 of 221 results

Results per page:

Viral Vectors 101: Optogenetic Tools

Antibodies 101: Multiplex Immunofluorescence

Technique: Probe Phage Genomes for Host Binding Proteins

Generating Mouse Models Using CRISPR/Cas9

PiggyBac-ing Through the Genome Editing Field

Finding Your Perfect Job After University

Building Global Connections with the International Mentorship Program USA-EUROPE

Luciferase Plasmid Collection

Important Considerations When Using AAVs

Custom CRISPR Screens & the Green Listed Software

Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

Plasmids 101: Modular Cloning Applications and Kits

Special Delivery: Fluorophore Targeting for FRET Studies

Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation

A Needle in a Base-Stack: Cas9 Structural Biology

Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

Antibody Validation for Flow Cytometry

Validated gRNA Sequences

Optogenetics + CRISPR, Using Light to Control Genome Editing

CRISPR 101: Cytosine and Adenine Base Editors

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections