We narrowed to 222 results for: rras

1. Viral Vectors 101: Optogenetic Tools

   Type

   Blog Post

   .../doi.org/10.1073/pnas.1936192100 Tichy, A.-M., Gerrard, E. J., Sexton, P. M., & Janovjak, H. (2019). Light-activated...

2. Antibodies 101: Multiplex Immunofluorescence

   Type

   Blog Post

   ...Dumitras, C., Gong, B., Nguyen, K., Van Der List, D., Murray, K. D., Engebrecht, J., & Trimmer, J. S. (2019)...

3. Technique: Probe Phage Genomes for Host Binding Proteins

   Type

   Blog Post

   ...firmly onto each to remove cell debris. Then, UV-irradiate the membranes for 15 min to kill any remaining...

4. Generating Mouse Models Using CRISPR/Cas9

   Type

   Blog Post

   ..., Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex Genome Engineering...

5. PiggyBac-ing Through the Genome Editing Field

   Type

   Blog Post

   ...s chromatin structure undergoes significant rearrangement (such as when a stem cell initiates differentiation...

6. Finding Your Perfect Job After University

   Type

   Blog Post

   ...project to validate some genomic changes, so this arrangement was ideal for everyone.  The cutting edge science...

7. Building Global Connections with the International Mentorship Program USA-EUROPE

   Type

   Blog Post

   ...University Miguel de Cervantes, the University of Navarra, and the University of the Basque Country. Mentees...

8. Important Considerations When Using AAVs

   Type

   Blog Post

   ...therapy 8.16 (2001): 1248. PubMed PMID: 11509958. 8. Ferrari, Forrest K., et al. "Second-strand synthesis is...

9. Luciferase Plasmid Collection

   Type

   Collection

   ...promoter is present for normalization Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion...

10. Plasmids 101: Modular Cloning Applications and Kits

    Type

    Blog Post

    ...perfect combination. The EcoFlex Kit has a wide array of DNA parts that can be assembled into individual...

11. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type

    Blog Post

    ...for error-free knock-in at both alleles may be warranted (20-30% of all tagged clones were bi-allelic in...

12. Custom CRISPR Screens & the Green Listed Software

    Type

    Blog Post

    ...the Output_Short file directly. We have used CustomArray, Inc for this purpose.  The gRNA oligos are...

13. Special Delivery: Fluorophore Targeting for FRET Studies

    Type

    Blog Post

    ...100 Å). Researchers have developed an extensive array of chemical labeling strategies suitable for targeting...

14. A Needle in a Base-Stack: Cas9 Structural Biology

    Type

    Blog Post

    ...Cas9 grips nucleotides 1-10 of the guide RNA, prearranged for base pairing with a complementary DNA strand...

15. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type

    Blog Post

    ...to iPSCs and re-establishment after Partial rearrangement from one cell type to another Time and resources...

16. Antibody Validation for Flow Cytometry

    Type

    Blog Post

    ... Bolivar, S. G., Ruiz Moleon, V., Eckmann, P., Worrall, D., McDowell, I., Southern, K., Reintsch, W., ...

17. Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

    Type

    Blog Post

    ...academia as well as the non-profit sector are transferrable to industry such as technology transfer, communications...

18. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type

    Blog Post

    ... K866PCK mutant was indeed inactive prior to irradiation with UV light (365nm) and that post-UV exposure...

19. CRISPR/Cas9 FAQs Answered!

    Type

    Blog Post

    ...R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome ...

20. Validated gRNA Sequences

    Type

    Collection

    ...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285...