We narrowed to 222 results for: rras
-
TypeBlog Post.../doi.org/10.1073/pnas.1936192100 Tichy, A.-M., Gerrard, E. J., Sexton, P. M., & Janovjak, H. (2019). Light-activated...
-
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post...Dumitras, C., Gong, B., Nguyen, K., Van Der List, D., Murray, K. D., Engebrecht, J., & Trimmer, J. S. (2019)... -
Technique: Probe Phage Genomes for Host Binding Proteins
TypeBlog Post...firmly onto each to remove cell debris. Then, UV-irradiate the membranes for 15 min to kill any remaining... -
Generating Mouse Models Using CRISPR/Cas9
TypeBlog Post..., Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex Genome Engineering... -
PiggyBac-ing Through the Genome Editing Field
TypeBlog Post...s chromatin structure undergoes significant rearrangement (such as when a stem cell initiates differentiation... -
Finding Your Perfect Job After University
TypeBlog Post...project to validate some genomic changes, so this arrangement was ideal for everyone. The cutting edge science... -
Building Global Connections with the International Mentorship Program USA-EUROPE
TypeBlog Post...University Miguel de Cervantes, the University of Navarra, and the University of the Basque Country. Mentees... -
Important Considerations When Using AAVs
TypeBlog Post...therapy 8.16 (2001): 1248. PubMed PMID: 11509958. 8. Ferrari, Forrest K., et al. "Second-strand synthesis is... -
Luciferase Plasmid Collection
TypeCollection...promoter is present for normalization Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion... -
Plasmids 101: Modular Cloning Applications and Kits
TypeBlog Post...perfect combination. The EcoFlex Kit has a wide array of DNA parts that can be assembled into individual... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...for error-free knock-in at both alleles may be warranted (20-30% of all tagged clones were bi-allelic in... -
Custom CRISPR Screens & the Green Listed Software
TypeBlog Post...the Output_Short file directly. We have used CustomArray, Inc for this purpose. The gRNA oligos are... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...100 Å). Researchers have developed an extensive array of chemical labeling strategies suitable for targeting... -
A Needle in a Base-Stack: Cas9 Structural Biology
TypeBlog Post...Cas9 grips nucleotides 1-10 of the guide RNA, prearranged for base pairing with a complementary DNA strand... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...to iPSCs and re-establishment after Partial rearrangement from one cell type to another Time and resources... -
Antibody Validation for Flow Cytometry
TypeBlog Post... Bolivar, S. G., Ruiz Moleon, V., Eckmann, P., Worrall, D., McDowell, I., Southern, K., Reintsch, W., ... -
Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs
TypeBlog Post...academia as well as the non-profit sector are transferrable to industry such as technology transfer, communications... -
Optogenetics + CRISPR, Using Light to Control Genome Editing
TypeBlog Post... K866PCK mutant was indeed inactive prior to irradiation with UV light (365nm) and that post-UV exposure... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome ... -
Validated gRNA Sequences
TypeCollection...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285...