Skip to main content

We narrowed to 1,052 results for: fer

Showing: 261 - 280 of 1052 results
  1. Viral Vectors 101: Viral Vector Elements

    Type
    Blog Post
    ...discussed are compiled for reference below. Happy virus making!  References and Resources Kulanayake,...the delivered cargo (often a gene) is called the transfer plasmid while the other plasmids with packaging... or something similar, and is contained on the transfer plasmid. If expression is the goal, a promoter...promoter and terminator regions and are slightly different in sequence. Both LTRs do share common repeat ...Adeno-associated virus AAV’s elements are quite different from gamma-retrovirus, but they perform very similar...delivered and expressed in the host cell from the transfer plasmid. Viral packaging and entry The viral packaging...which allows for altered tropism of AAV to target different tissue or cell types. AAV also requires some back...
  2. A Novice's Perspective on Neuroscience - SfN2017

    Type
    Blog Post
    ...for Neuroscience 2017 conference in Washington DC (#SfN17). This massive conference attracted over 30,000...-depth exposure to neuroscience prior to this conference was a rotation in Qiao Zhou’s lab in graduate...school where I worked on a project aiming to dedifferentiate mouse brain cells into neural stem cells. I...biologists. This was not at all the case. The conference featured people who work in sociology, behavior... Collider and which featured a talk about the different parts of the brain stimulated by stories. In retrospect...neuroscientists are using techniques from across different disciplines to better understand neurobiology ...develop technologies that will have impacts on many different facets of life. It also seems as if many of the...
  3. The Many Reasons for Irreproducible Research- and a Vaccine to Eradicate It

    Type
    Blog Post
    ...unaccounted for, may lead to different results. Different setting, different population, new genetic variation...obtaining a different result after conducting a replication study. An important difference between the...images, measuring the main outcomes in several different ways, and other questionable research practices..., simple noise in the process of sampling and inference-making. Even perfect transparent and rigorous ...variation, or different handling can all be important.  If we eliminate the problems above: unclear methods...previously unknown variable actually makes a big difference for the robustness of the findings.   How do...investigated to look for unexpected trends or differences between groups. Hypothesis generation is critical...
  4. Reproducibility for Everyone: Lessons from an Open Science Collaboration

    Type
    Blog Post
    ...everyone at this specific conference, and I was able to include and exclude different modules for this workshop...something about it. Building a diverse team with different talents and expertise Fortunately, the eLife ambassadors...realized that holding the next one at a scientific conference could potentially enable reproducibility practices...it physically to instruct the workshop at the conference, but because each contributor made the materials...open and modular nature of the workshop content: different parts could be mixed and matched to serve a specific...the lookout for upcoming workshops at future conferences this year. Workshops are confirmed for the Evolution... having a workshop organized at your upcoming conference or you’d like to join or contribute to this collaboration...
  5. Antibodies 101: Conjugation

    Type
    Blog Post
    ...antibody’s buffer is compatible with your conjugation kit, since many common antibody buffers and buffer additives...are provided in a buffer with the antimicrobial agent sodium azide, which can interfere with conjugation...good base from which to dive deeper!References and resources References Bendall SC, Nolan GP, Roederer M,...love FPbase’s Spectra Viewer tool for comparing different fluorophores. We also touched on fluorophores ...chemical coupling can be achieved through several different mechanisms. Most take advantage of chemical groups... resources on the Addgene blog Antibodies 101: Buffers, Storage, and ConjugatesAntibodies 101: The Basics...
  6. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ...section, teams are assigned different groups of three genes selected from different parts of the Met pathway...first select a multi-gene pathway to study and a reference organism where deletion strains are available....Students next transform deletion strains from the reference organisms with the overexpression plasmids. Finally...species has a similar function to the gene in the reference species. We have been using yeast models (3, 4...yeast, Saccharomyces. cerevisiae, makes a great reference organism for the project because it is non-pathogenic.... Over time, the two genomes have become very different due to a whole genome duplication and extensive...cloning to insert the coding sequences for ten different MET/Met genes (Figure 1) from the two yeast species...
  7. Antibodies 101: ELISA (Enzyme-linked Immunosorbent Assay)

    Type
    Blog Post
    ... Types of ELISA There are four different types of ELISAs, which differ in the way the antigen is detected... to run an ELISA in your lab!   References and resources References Boguszewska, K., Szewczuk, M., Urbaniak...Antibodies are used in many different experiments that require scientists to detect proteins in their...antibody and the detection antibody recognize different epitopes on the target protein, so they do not... for which multiple antibodies that recognize different epitopes are available; this type of ELISA is ... are coated with another protein — known as a reference antigen — that can also bind to that antibody....antigen as the other types of ELISAs require two different antibodies. As mentioned above, it can also be...
  8. A Look at Addgene's QC Process

    Type
    Blog Post
    ...reads are mapped against a reference sequence, if one was provided. If no reference is given, de novo assembly...functioning properly or be something completely different than what was originally intended. Sharing unverified...scientists worldwide. Depositing scientists provide different types of data for each of their plasmids, from...plasmid sequence de novo (without the use of a reference sequence) using a bioinformatics pipeline developed...scientists to easily visualize and identify sequence differences between our NGS results and deposited sequences...mismatches in significant plasmid elements. Which differences are considered a QC issue is reviewed yearly ...approaches to confirm plasmid sequences without a reference; and identifying mixed plasmid and nucleotide ...
  9. Tips for Titering Your Lentiviral Preps

    Type
    Blog Post
    ...drawbacks of different methods (for comprehensive protocols for all of the methods discussed here refer to Kutner...the correct transfer plasmid was used in the transfection; if preparing several different lentiviruses...assaying for expression of a gene carried on the transfer plasmid or quantifying the number of viral copies...resistance-genes, or the transgene itself. Many researchers prefer to design primers that target the common features...utilizes the antibiotic resistance genes carried on transfer plasmids. Target cells are transduced with serial...that standard conditions be used when comparing different batches of virus. In addition, some viral preps...step of a successful transduction experiment. References 1. Kutner, Robert H., Xian-Yang Zhang, and Jakob...
  10. Gaining Leadership Skills Volunteering at a Professional Organization

    Type
    Blog Post
    ...to learn how to adapt to different situations and, in particular, to different styles of leadership. As... one gain such experience? Your institution may offer occasional workshops on leadership and management...to learn more. Having met many people at that conference, I later became involved with the NPA beyond ... the Committee which I then led for 5 years.  Different leadership styles Being an effective leader requires...requires you to understand how to work with many different types of people both above and below you. During...relationships with these individuals who often had different styles from their predecessors. Changes were implemented...mission of the NPA. You must accommodate many different types of people in order to harness their strengths...
  11. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ... in mice Many systemic capsids express differently in different mouse strains, a phenomenon that we are...And these differences occur not just between mice and NHPs; some capsids show both different efficacy ... systemic capsids. After some consideration, we offer this definition: A systemic capsid is a capsid that...Organism Mouse Strain-Specific Tropism?  Reference AAV-PHP.B* CNS (broad) Mice, rats Yes...sex-independent and does not show significant differences in transduction efficiency between C57BL/6J and...transduction efficiency varying from 10-70% in different regions of the brain (Ravindra Kumar et al., 2020.../cJ and CBA/J mice. AAV1-X1 was developed by transferring the 7-mer peptide region from variable region...
  12. Promoters

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Promoters Promoters Prokaryotic Promoters Eukaryotic...mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding strand,...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Figure 2. Basic structure...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter...can drive expression in specific cells or under different conditions. Promoter Expression Species Description... types of RNA polymerases that all transcribe different genes: RNA polymerase I — transcribes genes encoding...
  13. Antibodies 101: Conventional vs Spectral Flow Cytometry

    Type
    Blog Post
    ...overlapping markers. Compensation/reference control(s) Compensation or “reference” controls are samples stained...spectral flow cytometry are more alike than they are different, there are a few aspects in which spectral flow...complex mathematical algorithm and single stained reference controls to distinguish one fluorophore from another...   Figure 3: Similarity index across 12 different colors on a three laser spectral flow cytometer...conventional or spectral flow. In spectral flow, reference controls tell the software to look for that exact...is not the same as your single color control. Reference controls: Beads or cells? Compensation beads are...new panel on a spectral cytometer, you prepare reference controls of both beads and cells for a single ...
  14. Common Injection Routes in Mice

    Type
    Blog Post
    ...discomfort of the mice, and restraint method. Many different substances can be injected, including cells, drugs...through the tail vein — many researchers will simply refer to these as “tail vein injections.” However, they.... They are a popular choice for administering different drugs and viral vectors. Like IV injections, intraperitoneal...flat, and easily accessible (like the back) is preferred. A common use of intradermal injections is studying...techniques may come in handy. These techniques are referred to as “instillation” or “gavage,” as they do not...as both procedures target the lungs. The main differences are that intranasal is easier, less invasive,...be flexible or metal, depending on researcher preferences. It sounds complicated but has a pretty low learning...
  15. Tips for Using BLAST to Verify Plasmids

    Type
    Blog Post
    ... of the plasmids in our repository with known reference sequences, such as full plasmid sequences provided...BLAST, which includes a simple explanation of the different BLAST programs, databases, and elements of the...The blastp and blastx programs are optimized differently and you may want to select one (or both) depending...you want to verify. We will delve into these differences below. Optimizing blastn searches On the Standard... a Sanger sequencing result to a single known reference sequence or to a BLAST sequence database. If you...two or more sequences” checkbox and paste your reference sequence into the Subject Sequence box that appears...BLAST searches. If you do not know the exact reference sequence for your result, choose one of the BLAST...
  16. How to Design Your gRNA for CRISPR Genome Editing

    Type
    Blog Post
    ...exact location of the TSS. Different databases annotate the TSS in different ways, and it has been shown...phenotype of interest. This blog post will discuss differences between these approaches, and provide updates...Doench et al., 2017, and Hanna et al., 2020) and references therein.   {% module_block module "widget_fcf9eab0...are so few gRNAs to choose from that sequence preferences must largely be ignored. Created with ...few potential gRNAs. While SpCas9, with a PAM preference of NGG, is still the most widely-used Cas enzyme...Cas12a enzymes, and engineered variants thereof offers additional PAM options that can greatly expand ... with BioRender.com. Two newer technologies offer an alternative to HDR for introducing edits. The...
  17. Uncovering Ancestral Bias in CRISPR Research

    Type
    Blog Post
    ... that differences in gene expression could explain why some ancestry groups were differentially dependent...ancestry-associated genes.   What does the reference genome actually reference?  The CRISPR guides used in the screens...done in this preprint.   Resources and references References Germline variation contributes to false... were designed to have a perfect match to the reference genome – even single mismatches within a CRISPR...introduce significant bias into the results. But the reference genome does not represent the diversity of genetic...understand how the use of a primarily European reference genome could affect their analysis. Their work...these and any other CRISPR screens using the same reference genomes and libraries. Further complicating the...
  18. What’s in Your Tube?: A Quick Guide to Measuring DNA by Spectrophotometry

    Type
    Blog Post
    ...Addgene blog Plasmid Preps: Different Purity, Different Quantities, Different Uses What's the Best Way to... our blog and website.          References and Resources References Ahlfen SV, Schlumpberger M. Effects...Each of these contaminants will have a slightly different impact on the spectra of a mixed sample.  ...A260/230 of ~2.0. However, let’s break down how different contaminants impact these ratios.  Protein contaminants...significantly at low concentrations.  The elution buffer you use will also affect how accurate your measurements...give more variable absorbance readings. A Tris-buffered solution tends to produce more consistent readings... instrument you use and check out some of the references we have provided below. And if you do have trouble...
  19. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ... the split-luciferase system, intein-mediated splicing reconstitutes functional luciferase only when fusions...when separated (2), and that DBD and TAs from different systems could be combined effectively (3). In ...target gene, in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with...sequence of the DBD. The DBD-POI fusion (commonly referred to as the “bait”, Figure 2b) cannot activate reporter...interact, this will bring the POI-TA fusion (commonly referred to as the “prey”) in close enough proximity to... fusions of the two halves of the luciferase protein interact and enable intein splicing (5). Screening...a more vigourous screen is to use a number of different bait and prey vectors. This has been shown to ...
  20. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...
Showing: 261 - 280 of 1052 results