We narrowed to 327 results for: INO

1. How to Negotiate a Successful Lab Start Up Budget

   Type

   Blog Post

   ...all the major equipment, categorize all of your minor tools, like pipets, or mini-centrifuges, etc. Be...

2. Hot Plasmids: Spring 2025

   Type

   Blog Post

   ...proteoglycans composed of a protein core, 2–4 glycosaminoglycans (GAG), and are (typically) tethered to the...

3. Viral Vectors 101: AAV Serotypes and Tissue Tropism

   Type

   Blog Post

   ... natural hybrid of AAV1 and AAV2, with only six amino acids distinguishing its capsids from those of AAV1...

4. Viral Vectors 101: Optogenetic Tools

   Type

   Blog Post

   ..., Raja, C., Chibukhchyan, A., Ramakrishnan, C., Inoue, M., Shane, J. C., McKnight, D. J., Yoshizawa, S...

5. Viral Vectors 101: AAV Variables That Matter

   Type

   Blog Post

   ...j.omtn.2017.03.009 Watakabe, A., Ohtsuka, M., Kinoshita, M., Takaji, M., Isa, K., Mizukami, H., Ozawa,...

6. Antibodies 101: Multiplex Immunofluorescence

   Type

   Blog Post

   ...doi.org/10.17504/protocols.io.bs68nhhw Im, K., Mareninov, S., Diaz, M. F. P., & Yong, W. H. (2019). An ...

7. Plasmids 101: Dimers and Multimers

   Type

   Blog Post

   ...Characterization of multiple circular DNA forms of colicinogenic factor E-1 from Proteus mirabilis. Biochemistry...

8. Antibodies 101: The Basics of Western Blotting

   Type

   Blog Post

   ... loading. Denature the samples to their primary amino acid sequence by boiling in the presence of a reducing...

9. Technologies Enabled by NanoLuc® Luciferase

   Type

   Blog Post

   ... from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7, 1848-57. PubMed...

10. PiggyBac-ing Through the Genome Editing Field

    Type

    Blog Post

    ...pair changes as would be the case with ssODNs. One minor drawback with using PBx for excision is its efficiency...

11. Validated gRNA Sequences

    Type

    Collection

    ...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S...

12. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type

    Blog Post

    ...target. The (T)TTN PAM motif required by the Acidaminococcus sp. BV3L6 Cas12a (AsCpf1) eases this constraint...

13. A Guide to Getting Started in Undergrad Research

    Type

    Blog Post

    ...generation students, women, BIPOC, and other minoritized populations. Research universities often have...

14. Quick Guide to All Things Lentivirus

    Type

    Blog Post

    ...order to aid viral binding. This method, called spinoculation, has been found very effective for T cells transduction...

15. Antibodies 101: Designing Your First Flow Panel

    Type

    Blog Post

    ...ultraviolet (UV) light, they do so via aromatic amino acids found in all proteins, so you can't distinguish...

16. Custom CRISPR Screens & the Green Listed Software

    Type

    Blog Post

    ...PubMed Central PMCID: PMC4559080. 5. Tzelepis, Konstantinos, et al. "A CRISPR dropout screen identifies ...

17. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type

    Blog Post

    ...’s excitation spectrum- a major 397 nm peak and minor 475 nm peak, respectively. When wtGFP is illuminated...

18. Cancer and the Immune System: Deciphering the Relationship

    Type

    Blog Post

    ... recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced ...

19. How to Deposit Your Plasmids with Addgene

    Type

    Blog Post

    ...standard mutation notation. Please indicate the amino acid change as well as any functional consequences...

20. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type

    Blog Post

    ...base editors have the potential to correct only a minority of those variants in most cell types. But prime...