We narrowed to 320 results for: INO

1. Technologies Enabled by NanoLuc® Luciferase

   Type

   Blog Post

   ... from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7, 1848-57. PubMed...

2. PiggyBac-ing Through the Genome Editing Field

   Type

   Blog Post

   ...pair changes as would be the case with ssODNs. One minor drawback with using PBx for excision is its efficiency...

3. Quick Guide to All Things Lentivirus

   Type

   Blog Post

   ...order to aid viral binding. This method, called spinoculation, has been found very effective for T cells transduction...

4. A Guide to Getting Started in Undergrad Research

   Type

   Blog Post

   ...generation students, women, BIPOC, and other minoritized populations. Research universities often have...

5. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

   Type

   Blog Post

   ...target. The (T)TTN PAM motif required by the Acidaminococcus sp. BV3L6 Cas12a (AsCpf1) eases this constraint...

6. Plasmids for Stem Cell Research

   Type

   Collection

   ... reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol...

7. Custom CRISPR Screens & the Green Listed Software

   Type

   Blog Post

   ...PubMed Central PMCID: PMC4559080. 5. Tzelepis, Konstantinos, et al. "A CRISPR dropout screen identifies ...

8. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

   Type

   Blog Post

   ...’s excitation spectrum- a major 397 nm peak and minor 475 nm peak, respectively. When wtGFP is illuminated...

9. Cancer and the Immune System: Deciphering the Relationship

   Type

   Blog Post

   ... recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced ...

10. Antibodies 101: Designing Your First Flow Panel

    Type

    Blog Post

    ...ultraviolet (UV) light, they do so via aromatic amino acids found in all proteins, so you can't distinguish...

11. How to Deposit Your Plasmids with Addgene

    Type

    Blog Post

    ...standard mutation notation. Please indicate the amino acid change as well as any functional consequences...

12. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type

    Blog Post

    ...base editors have the potential to correct only a minority of those variants in most cell types. But prime...

13. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type

    Blog Post

    ...learn more about site-specific incorporation of amino acids using pyrrolysl tRNA synthetase, read this...

14. Delivery Methods for Generating iPSCs

    Type

    Blog Post

    ...comments below! References  1. Sano, Masayuki, Minoru Iijima, Manami Ohtaka, and Mahito Nakanishi. "Novel...

15. Validated gRNA Sequences

    Type

    Collection

    ...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S...

16. 15 Hot Plasmids from 2017

    Type

    Blog Post

    ...reprogramming discrepancies, which they traced to a 9 amino acid N-terminal variation in the Klf4 isoform (KLF4s...

17. Troubleshooting and Optimizing a Western Blot

    Type

    Blog Post

    ...modifications Check literature Highly charged amino acids Run control protein (if available) and note...

18. Cre-lox system

    Type

    Collection

    ...vector for Pax7 Tanaka 111187 pBADZ-HisCre Cre; arabinose inducible. PBAD promoter Bacterial Richmond 112614...

19. 22 Hot Plasmid Technologies from 2014

    Type

    Blog Post

    ...serine phosphorylation by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al....

20. 27 Hot Plasmids from 2016

    Type

    Blog Post

    ...connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The key to the biosensor...