We narrowed to 327 results for: INO
-
TypeBlog Post...all the major equipment, categorize all of your minor tools, like pipets, or mini-centrifuges, etc. Be...
-
Hot Plasmids: Spring 2025
TypeBlog Post...proteoglycans composed of a protein core, 2–4 glycosaminoglycans (GAG), and are (typically) tethered to the... -
Viral Vectors 101: AAV Serotypes and Tissue Tropism
TypeBlog Post... natural hybrid of AAV1 and AAV2, with only six amino acids distinguishing its capsids from those of AAV1... -
Viral Vectors 101: Optogenetic Tools
TypeBlog Post..., Raja, C., Chibukhchyan, A., Ramakrishnan, C., Inoue, M., Shane, J. C., McKnight, D. J., Yoshizawa, S... -
Viral Vectors 101: AAV Variables That Matter
TypeBlog Post...j.omtn.2017.03.009 Watakabe, A., Ohtsuka, M., Kinoshita, M., Takaji, M., Isa, K., Mizukami, H., Ozawa,... -
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post...doi.org/10.17504/protocols.io.bs68nhhw Im, K., Mareninov, S., Diaz, M. F. P., & Yong, W. H. (2019). An ... -
Plasmids 101: Dimers and Multimers
TypeBlog Post...Characterization of multiple circular DNA forms of colicinogenic factor E-1 from Proteus mirabilis. Biochemistry... -
Antibodies 101: The Basics of Western Blotting
TypeBlog Post... loading. Denature the samples to their primary amino acid sequence by boiling in the presence of a reducing... -
Technologies Enabled by NanoLuc® Luciferase
TypeBlog Post... from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol 7, 1848-57. PubMed... -
PiggyBac-ing Through the Genome Editing Field
TypeBlog Post...pair changes as would be the case with ssODNs. One minor drawback with using PBx for excision is its efficiency... -
Validated gRNA Sequences
TypeCollection...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S... -
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency
TypeBlog Post...target. The (T)TTN PAM motif required by the Acidaminococcus sp. BV3L6 Cas12a (AsCpf1) eases this constraint... -
A Guide to Getting Started in Undergrad Research
TypeBlog Post...generation students, women, BIPOC, and other minoritized populations. Research universities often have... -
Quick Guide to All Things Lentivirus
TypeBlog Post...order to aid viral binding. This method, called spinoculation, has been found very effective for T cells transduction... -
Antibodies 101: Designing Your First Flow Panel
TypeBlog Post...ultraviolet (UV) light, they do so via aromatic amino acids found in all proteins, so you can't distinguish... -
Custom CRISPR Screens & the Green Listed Software
TypeBlog Post...PubMed Central PMCID: PMC4559080. 5. Tzelepis, Konstantinos, et al. "A CRISPR dropout screen identifies ... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...’s excitation spectrum- a major 397 nm peak and minor 475 nm peak, respectively. When wtGFP is illuminated... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post... recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced ... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...standard mutation notation. Please indicate the amino acid change as well as any functional consequences... -
Prime Editing: Adding Precision and Flexibility to CRISPR Editing
TypeBlog Post...base editors have the potential to correct only a minority of those variants in most cell types. But prime...