Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 399 results for: MUT

Showing: 341 - 360 of 399 results

  1. CRISPR Plasmids - Plants

    Type
    Collection
    ... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

  2. Neurodegeneration Research Collection

    Type
    Collection
    ...dominant manner, are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, ... huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins with abnormally...-onset forms, a fraction of these are due to a mutation in one of three different inherited genes: Presenilin... collection of plasmids expressing wild type or mutant ORFs, gene fragments, and gRNAs for genes linked...

  3. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...precise gene editing. These edits can include mutations seen in human patients, protein tags, or loxP/...editing rates. Advances in this area include: Nickase mutant: cuts only one strand of DNA and can be used with...off-target activity due to rationally designed mutations. Researchers have expanded the CRISPR field beyond...to be used together. Researchers have engineered mutant Cas enzymes with alternative PAM sites . Cpf1 ,...

  4. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...fluorescent marker. Injection into a conditional mutant mouse brain that expressed Cre recombinase only...

  5. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...Design Tools CRISPR Blog Posts CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

  6. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

  7. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Izaurralde 147272 pAc5.1B-lambdaN-HA-DmeIF4Ga-4Ebind-mut-dsRNAres_Q EIF4G His, HA, V5 Ac5 Parkinson's Elisa...17798 pM-ErbB4CTF-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol 17799 pM-ErbB4CTF-PY3 mutant ERBB4 GAL4-BD ALS...delta-kinase-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol 17802 pM-ErbB4-delta-kinase-PY3 mutant ERBB4 GAL4-BD...below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent protein (FP) ...Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized gRNA Other Tags... YFP GAL1 ALS Aaron Gitler 29608 426Gal-FUS-RRM Mutant-YFP FUS YFP GAL1 ALS Aaron Gitler 29609 pcDNA 3.2...TMEM106B_Halo_C_allele TMEM106B Halo Frontotemporal dementia in GRN mutation carriers Michael Ward 178174 VAPB_Halo_C_allele...

  8. Zhang Lab CRISPR Page

    Type
    Collection
    ...loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading...KRAS , p53 and LKB1 , the top three significantly mutated genes in lung adenocarcinoma. Delivery of a single...

  9. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...construct leads to a change in signal of a circularly permuted fluorescent protein (cpFP) or Förster resonance...Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut biosensor for extracellular ATP (Constitutive ...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...pHluorin2 for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity...

  10. Validated gRNA Sequences

    Type
    Collection
    ...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere... 72628 cut S. pyogenes 26493208 Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere...

  11. Ginkgo Bioworks COVID-19 Collection

    Type
    Collection
    ...SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression (recode...making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Resources Read Addgene's...

  12. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...editing systems include targeted AID-mediated mutagenesis (TAM) from the Chang lab and CRISPR-X from the...

  13. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...ZFNs) are effective tools for making targeted mutations in zebrafish. With support from the NIH and guidance...):1471-1501. PubMed PMID 19798082 . Targeted mutagenesis in zebrafish using customized zinc-finger nucleases...

  14. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...name, capsid, and more. ID Plasmid Gene/Insert Mutations PI AAV Plasmids This table contains a general .... ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI Do you have suggestions for other plasmids...

  15. Plant Plasmids and Resources

    Type
    Collection
    ...(Link opens in a new window) for Targeted Gene Mutation in Rice - Yinong Yang. The MoClo CRISPR/Cas Toolkit...assembly for fast generation of multiple Arabidopsis mutants - Niko Geldner. CRISPR-Cas9 vector with GRF4-GIF1...

  16. Zebrafish Plasmid Collection

    Type
    Collection
    ...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9... typically relies on genetic markers, somatic mutations, or labeling with fluorescent proteins to visualize...

  17. Ras Pathway

    Type
    Collection
    ...regulating the growth of the cell, however when mutations occur in the Ras gene it can be stuck in a constitutively...PubMed PMID: 17428555 . RAS signaling pathways, mutations and their role in colorectal cancer. Zenonos K...

  18. Tetracycline Inducible Expression

    Type
    Collection
    ...On System In 1995, Gossen et al. used random mutagenesis to identify which amino acid residues of tetR...important for tetracycline-dependent repression. Mutating these residues led to the development of a reverse...

  19. CRISPR Plasmids - Tagging

    Type
    Collection
    ...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ... 10-day protocol, generates “clean” homozygous mutants with no co-integrated markers or footprints, and...

  20. Retrograde AAV viral preps

    Type
    Collection
    ...Norepinephrine sensor Li 123310 pAAV-hSyn-GRAB_NEmut Syn GRAB-NEmut control norepinephrine sensor (does not...
Showing: 341 - 360 of 399 results