Skip to main content
Addgene

We narrowed to 138 results for: THY-2

Showing: 11 - 20 of 138 results
  1. Neurodegeneration Research Collection

    Type
    Collection
    ...New and Noteworthy: Use tau constructs to study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...guide to using plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein...system, vesicular brain cells and more. New and Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep ...and fibroblasts into neurons and more. New and Noteworthy: Study aberrant axon initial segment (AIS) plasticity...
  2. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...
  3. mTOR Pathway

    Type
    Collection
    ...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...Complex Symbol Name AKT AKT1 AKT2 AKT3 v-akt murine thymoma viral oncogene homolog FOXO Forkhead box O GBL/...
  4. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...including histone acetylation/demethylation, and cytosine methylation/demethylation. CRISPR...p300 histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These...
  5. CRISPR Guide

    Type
    Collection
    ...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...
  6. TALEN Guide

    Type
    Collection
    ...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...targets cytosine, NI targets adenenine, NG targets thymine, and NN targets guanine (though NN can also bind...
  7. A Look Back at One Year of Plasmid Sharing for COVID-19 Research

    Type
    Blog Post
    ...SARS-CoV-2 spike pseudotyping, visit the SARS-CoV-2 Pseudotyped Virus collection page. SARS-CoV-2 detection...of SARS-CoV-2 entry and become upregulated during viral infection.  Expression of SARS-CoV-2 viral proteins...labs in over 75 countries. Figure 1: SARS-CoV-2 proteins and other components. Image from Maya Kostman... protein, variants, and pseudotyping The SARS-CoV-2 virus depends on its spike protein to bind ACE2, the...of infection and how to interfere with it in a BSL-2 lab instead of a BSL-3 lab. Jesse Bloom’s lab published...reagents for pseudotyping lentivirus with the SARS-CoV-2 spike protein. They deposited the plasmids used for...individuals are at neutralizing the different SARS-CoV-2 spike variants. You can learn more about their research...
  8. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ..., Sunkin SM, Smith KA, Esposito L, Waters J, Thyagarajan B, Yao S, Lein ES, Zeng H, Levi BP, Ngai J, Ting...
  9. Giving gRNAs a Facelift - Synthetic and Beyond

    Type
    Blog Post
    ...same site, is 2’-fluoro (2’-F), which substitutes a fluorine for the hydroxyl group at the 2’ position. ...most common of these is 2’-O-methylation, where a methyl group is added to the 2’ hydroxyl group of the...together, for example phosphorothioates with 2’-O-methyl modifications, proved more stability than just...generated by introduction of a single photocleavable 2-nitrobenzyl linker in the 20-bp targeting region of...linkages, unlocked nucleic acids, and a constrained ethyl.  Can’t decide which RNA backbone modification is...similar advantages, bridged nucleic acids with N-methyl substitutions are slightly more efficient and less...
  10. CRISPR Between the Genes: How to Experiment with Enhancers and Epigenomics

    Type
    Blog Post
    ...for the 2+ million DHS sites. See below for further details. DNA is a 3D Fractal Figure 2: DNA compaction...: 1. Find Enhancers that have NANOG binding sites 2. Design a CRISPR screen to target and disrupt the ...NANOG enhancers 3. CRISPR out the enhancers from step 2. See which ESCs die or differentiate Step 3 reveals...expression for NANOG enhancers, we’re ready for step 2: design a CRISPR screen to disrupt these enhancers...to CRISPR out the enhancers we identified in step 2. The result is a heterogenous population of stem cells... region that has mono-methylated and acetylated histones, but not tri-methylated histones, functions as...denote enhancers as follows: (mono_methylation + acetylation) - tri_methylation In the next section we’ll ...
Showing: 11 - 20 of 138 results