Skip to main content

We narrowed to 105 results for: myc tag

Showing: 31 - 60 of 105 results
  1. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...dedifferentiation stage involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that...More (due to additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming...lineage, without dedifferentiating into a pluripotent stage. Cellular reprogramming The reversal of a differentiated...reprogramming [1]. The process can be divided into two stages: Dedifferentiation - Conversion of adult somatic...differentiated somatic cell to revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate...reprogrammed to iPSCs successfully [10-12]. The next stage of reprogramming consists of redifferentiation of...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pTag-RFP-C-h-Rab5a-c-Myc Endosomes (early) Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Endosomes (early...pTag-BFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Endosomes...Harrison 79806 pTag-RFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc...) Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Endosomes (recycling) Rab4a TagBFP James Johnson...Corvera 42635 TagRFP-T-EEA1 Endosomes (early) EEA1 TagRFP-T Silvia Corvera 38770 pEF.myc.ER-E2-Crimson Endoplasmic...early) Rab5 TagBFP Gia Voeltz 61802 GFP-Rab5B Endosomes (early) Rab5B AcGFP Gia Voeltz 79802 pTag-RFP-C-h-...Mitochondria Mitochondrial targeting signal (COX4) TagBFP Gia Voeltz 55102 mCherry-Mito-7 Mitochondria Mitochondrial...
  3. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular tag, the IT6... for epitope tagging: Inntags When fused to your protein of interest (POI), epitope tags give you the...production of a new series of epitope tags, inntags (innocuous tags), that they believe will have fewer ...expressed either without a tag or as multiple fusions with different N- and C-terminal tags. Additionally, by ...Unfortunately, while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause ...expression of fusions between the POI and a TAP tag (a tag with two epitopes that can be used to sequentially...the POI-tag fusion from a plasmid or from a random genomic location than to express the tagged protein...
  4. Starter guide to induced pluripotent stem cells (iPSCs) part 1:  A renaissance in regenerative medicine

    Type
    Blog Post
    ...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...therapeutic purposes. Both types have their advantages and disadvantages. Here is a table listing some of them... system which combined the advantages of both while limiting disadvantages led to the creation of induced...cells found in the zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell ... Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine. ...
  5. Bacterial Expression Systems

    Type
    Collection
    ...used tags, cleavage sites, and signal peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA,...bacteria with different purification tag combinations, including PelB tags for localization to the periplasm...Protein Expression Protein Expression Epitope Tags Protein Tags Return to top Protein Visualization To determine..., proteins are often expressed alongside epitope tags, which can also later be used for protein detection...removed using protease cleavage sites. Other protein tags and signal peptides are used to enhance protein ...HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA Cleavage sites: TEV protease, factor Xa, enterokinase...localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification Resources...
  6. How to Write a Scientific Review Article

    Type
    Blog Post
    ... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...retreat to the woods for months at a time, so take advantage of whatever time you have. If you’re like me, ...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...expression gene of interest fused with 3xFLAG and 2xStrep-tag from TRE3G promoter for Tandem-Affinity Purification...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...operator ( tet O, a 19 nucleotide sequence, TCCCTATCAGTGATAGAGA). In normal conditions, the TetR protein ...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...
  8. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F GCGTTCAAAAGTCGCCTAAG...
  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Roux lab has deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...119 selectable marker, and “connectors” that link tags to the targeted gene are supplied to the reaction...editing in worms to the point that high-throughput tagging projects can be performed. Schwartz, et al. Genetics...lentiviral transfer vector. Each gene has been FLAG-tagged for convenient experimental use. The plasmids were...
  10. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...Epitope tag antibody collection grows By Ashley Waldron We are excited to highlight the Anti-V5 tag antibody... as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile option for tagging proteins...immunodeficiency virus p27 using tag-specific monoclonal antibody and tag-linked antigen. J Gen Virol., ...Figure 3: Expression of fluorophore-tagged GOLG-4 through eight stages of embryonic development. Representative...find in this post: Anti-V5 and other new epitope tag antibodies from IPI New tool for structural studies...studies of E3 ligase cereblon Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene...Innovation (IPI), part of a new collection of epitope tag antibodies available through Addgene. Anti-V5 [IPI-SV5...
  11. Targeted Mutagenesis with EvolvR

    Type
    Blog Post
    ... a unique tag into a genomic site of choice via the mutational abilities of PolI3m. This tag would allow...result in a spectinomycin resistant phenotype in bacteria. While there are many known spectinomycin resistance... for mutagenesis, a feature which they used to generate bacteria resistant to both spectinomycin and streptomycin...directed mutagenesis to generate specific mutations in your plasmids Use REPLACER Mutagenesis to mutate...Mutagenesis is a tool that both evolution and molecular biologists use to tinker with DNA. Making changes...region. EvolvR, a CRISPR-Cas9 based targeted mutagenesis method developed by the Dueber Lab at Berkeley...potential applications. Challenges of existing mutagenesis methods Several continuous diversification methods...
  12. Visualizing Protein Turnover In Situ

    Type
    Blog Post
    ...protein tags can be used to facilitate the visualization of specific proteins in cells. Tagged protein...containing AHA to a fluorescent alkyne tag. The newly synthesized and tagged proteins can then be observed with...the knock-in of fluorescent tags into the gene locus of interest. An advantage of this alternative is the...here, there is the question of whether or not the tags influence behavior. A conference and a breakthrough... known as fluorescence noncanonical amino acid tagging (FUNCAT, Dieterich et al. Nature Neuroscience, ...protein of interest that also had incorporated the AHA tag after pulse labeling of a determined period of time...used for cell labeling Check out other protein tagging strategies Additional Resources on Addgene.org...
  13. Your Top Requested Plasmid in 2016!

    Type
    Blog Post
    ... SpCas9 is also fused to a 3X FLAG tag at its N-terminus. This tag can be used to test for SpCas9 expression...Alternative forms of this vector contain GFP-tagged and un-tagged versions of SpCas9 and further variants ...SpCas9 is fused to the puromycin resistance gene through a 2A peptide. The puromycin resistance gene enables...causes the ribosome to translate Cas9-2A and the Puromycin resistance gene as separate peptides. PX459 This...predecessor, which had a point mutation in the puromycin resistance gene that made it less effective in...
  14. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...time. Creating a modular, selection-based gene tagging approach Multiple features of C. elegans have made... between a fluorescent protein (FP) and a 3xFLAG tag (see construct schematic below.) After self-excision...intron, and only the fluorescent protein and 3xFLAG-tag sequences are inserted into the genome. Figure...template plasmid to create fluorescent and 3xFLAG-tag fusion proteins. The repair template and Cas9-sgRNA.... (2015) illustrating the steps to fluorescently tag a C. elegans protein. The his-72 locus is shown as...little hands-on labor and could facilitate the tagging of every protein in the C. elegans genome. Although... gene tagging...
  15. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ..., modular plasmids, combining fluorescent tags, epitope tags, protease sites, and selection markers. These...fluorophore tagging vectors for your single or multi-color imaging experiments. Interested in epitope tags? Others...have genome tagging systems enabled you to advance your research? Do you have a favorite tagging system that...Researchers have long taken advantage of this natural process to integrate protein tags into the genomes of S...promoter substitution), and tagging at either the N- or C-terminus (3xHA, 13xMyc, GST, or GFP). Longtine ...especially useful in protein complex studies where tagging of multiple protein products is desired, as multiple...multiple selection markers can ensure that all desired tags have been integrated. Simply design your amplification...
  16. Tagging Optogenetics and Chemogenetics Receptors: Fluorescent Proteins and Other Options

    Type
    Blog Post
    ...transgene expression. Which tag should I use? When deciding on the appropriate tag, the experimental design...our studies suggest that non-fluorescent tags may be advantageous over fluorescent proteins when the fluorescence... methods, these proteins are routinely fused to ‘tag’ or ‘label’ proteins to facilitate its detection....detection. Fluorescent proteins are most widely used tags because they emit endogenous fluorescence that allow...protein (GFP) and mCherry, two of the most common tags currently used, are approximately 240 amino acids...most of them were still cytoplasmic. Use of ‘small’ tags to identify proteins Given the limited expression...monkey neurons, we next hypothesized that a different tag fused to the hM4Di might improve the transport of...
  17. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type
    Blog Post
    ...system for protein tagging. We spoke with Mendenhall and Myers about their new CRISPR tagging system, which...www.addgene.org/crispr/tagging. Addgene: What motivated you to adapt CRISPR for use in protein tagging? Myers: Our...epitope tag onto the transcription factors. By the way, you can actually use this for tagging any protein... resistance to neomycin so that you can select the population of cells with the tagged transcription factor...factors. Our groups got together to adapt CRISPR for tagging experiments and it’s already looking like it’s ...correctly, the second plasmid inserts a small epitope tag called FLAG at the end of the transcription factor...of advice for people who may want to apply this tagging system to their own work? Mendenhall: We’ve made...
  18. Molecular Biology Reference

    Type
    Guide
    ... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...sequence. Epitope tags, on the other hand, are commonly used in molecular cloning to tag a gene within a...random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication in addition...nucleotides. The four standard bases (dNTPs) are tagged with a different fluorophore so they can be distinguished...distinguished from one another. These tagged dNTPs also lack a binding site for the next nucleotide (denoted...because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA sequence...Like Sanger, NGS utilizes modified, fluorescently-tagged nucleotides. During Illumina NGS, a long piece ...
  19. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...can be found in Botman et al., 2019 . FP Tagging Yeast tagging vectors to create fusions of proteins of...Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https...plasmids to overexpress various fluorescent markers and tag your proteins of interest with fluorescent proteins...Collection Botman-Teusink Yeast FP Collection FP Tagging FP Overexpression Resources This comprehensive ...allows for constitutive overexpression of FPs and tagging of genes of interest with FPs in yeast. Characterization...TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication FP Overexpression Plasmids for constitutive...Improved blue, green, and red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902...
  20. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...electron microscopy (EM) tag providing superior subcellular localization of tagged proteins compared to traditional...contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep, CBP, Trx, GST, Halo, MBP, ...promoter, N-terminal tag, coding sequence of the gene of interest, C-terminal tag, plant terminator, and...of an isopeptide bond between 2 peptide tags, SpyTag and KTag. The group demonstrated the use of the SpyLigase...expression levels. APEX2 is a monomeric, 27 kD genetic tag which can be fused to proteins of interest for EM...same animal. Flipbow additionally incorporates SUMO tags in the FP sequence for separation from Cre-based...levels to be directly compared among the different tags To clone a sequence or gene of interest into the...
  21. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ... well as additional useful tags, including 3xFLAG epitopes, TEV and BioTag, which can be used in protein... protein effectivity), and a fluorescent protein tag for visualization (Fig. 1b). While the probes target...ultimately leading to the degradation of the AID-tagged protein. To quantify protein degradation the Ward...44 amino acids auxin inducible degron sequence) tagged proteins. Degradation of your protein interest ...Gibson and Saptrap cloning systems to generate AID* tagged CRISPR knock-in repair constructs. These repair...repair constructs can be used to integrate the tagged AID* into genomic sites of interests via CRISPR techniques...engineering plasmid tools in about a week. Taking advantage of Golden Gate cloning, the Haynes lab’s Protocols.io...
  22. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...make it possible to insert, or knock-in, any gene, tag, or mutated exon into the genome. For this purpose...promoter responds. You can also use this method to tag an endogenous protein with GFP, as seen in blue flame...where recombination has occurred. Neomycin, puromycin, and hygromycin resistance genes are commonly used...identical molecules of DNA. Gene targeting takes advantage of this natural process to replace a targeted ...insert a resistance gene. The vector contains a neomycin resistance gene (NeoR) flanked by homology arms...remove a resistance gene. In this construct, the neomycin resistance gene is floxed so that it can be removed...the sequence of GFP is cloned together with the Neomycin resistance (NeoR) gene between exon 1 and 3 of...
  23. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...cloned into an IPTG-inducible His-tag expression vector. All His-tags are cloned at the C-terminus of ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular biology...a TEV cleavage site is present between the 6xHis-tag and the coding region of MDH. For detailed clone ...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic...
  24. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...additionally contain various combinations of protein tags (His, Avi, and GFP) as well as protease sites to...researcher to quickly generate N- and C-terminal epitope tag fusions to a protein of interest. The plasmids used...folding and/or protease sites to remove the epitope tags. Different plasmids in the kit can be used to purify...2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...conveniently performed through the N-terminal eGFP tag carried on all constructs. The Cell-Free Protein ...et al. "Adaptation of Enterococcus faecalis to daptomycin reveals an ordered progression to resistance....
  25. Tips for arabidopsis transformation

    Type
    Blog Post
    ...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...
  26. Control AAV Preps

    Type
    Collection
    ...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity...non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive... 8 Karl Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...dependent 1, 5 Loren Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Joshua Sanes 45186... 9 Joshua Sanes 209658 pAAV.CAGFLEX.(cyto).cpSFGFP.HaloTag CAG None Cre dependent 5 Tim Brown and HHMI-JRC...
  27. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope tags or fluorescent...include mutations seen in human patients, protein tags, or loxP/FRT sites, among others. Homology-directed... not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also be used to purify a genomic locus... EM, Myers RM. 2015. CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res . ...and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and...
  28. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ... cloning procedure adds both V5 and His6 epitope tags to the C-termini of Met proteins, which can be used...methionine synthesis (5). The budding yeast, Saccharomyces. cerevisiae, makes a great reference organism... or not proteins from the fission yeast, Schizosaccharomyces pombe, have the same function as their counterparts...yeast for budding geneticists: A primer on the Saccharomyces cerevisiae model system. Genetics 197, 33-48...yeast for young geneticists: A primer on the Schizosaccharomyces pombe model system. Genetics 201, 402-423...Surdin-Kerjan, Y. Metabolism of sulfur amino acids in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 61, 503-532.... et al. Functional characterization of the Saccharomyces cerevisiae genome by gene deletion and parallel...
  29. Addgene-Seeding Labs plasmid grant round 3: microbial drug resistance and biofilms, antidiabetic plant components, visualizing brain injury - and a glowing robot fish

    Type
    Blog Post
    ... expressing fluorescent proteins will be used to tag individual strains of bacteria. Their interactions...Understanding drug resistance mechanisms of Mycobacterium tuberculosis Dr. Patricia Sheen, Universidad...interested in understanding the mechanisms behind Mycobacterium tuberculosis resistance to pyrazinamide (PZA...methods and improved therapies for PZA-resistant Mycobacteria tuberculosis. Investigation of multispecies ...
Showing: 31 - 60 of 105 results