Skip to main content
Addgene
Showing: 51 - 93 of 93 results
  1. Chemogenetics AAV Preps

    Type
    Collection
    ...mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre and Flp-dependent Constitutive (non-cre dependent..., 9, rg* Roth 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Sternson...Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics AAV Use our chemogenetics AAV to chemically... Gether 119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 ...119742 AAV SYN PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII... labs. See the Retrograde AAV Inventory Page . Browse all Chemogenetics AAV Don’t See What You’re Looking...dependent) Serotype AAV1 AAV2 AAV5 AAV8 AAV9 Retrograde AAV PHPeB Clear Filters ID Name Receptor and Activity...
  2. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ... how Cre-lox recombination works. Advances in Cre-lox recombination have included inducible Cre, such...adeno-associated viral vectors (AAV) available - AAV-EF1a-BbChT and AAV-EF1a-BbTagBY. These constructs ...Cai et al. also created an Autobow construct containing both Cre and XFPs. Cre production drives recombination...continued utility of Cre-lox. Check out our previous blog post, Plasmids 101: Cre-lox, if you need a quick...membrane tethered cyan). Without Cre recombination, RFP is expressed. Cre can mediate one of two deletions...construct, OFP (orange), is expressed when Cre is absent; stochastic Cre excision results in one of three recombinations...system employs Cre-mediated deletion, the design of Brainbow-2.1 cleverly combines Cre-mediated deletion...
  3. Hot Biosensors 2022: Year-End Roundup

    Type
    Blog Post
    ...-mRuby3 (AAV1) pGP-AAV-syn-jGCaMP8f-WPRE (AAV Retrograde) pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE (AAV Retrograde...constructs: pAAV-CAG-dLight1.2 (AAV1) pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE (AAV1) pAAV-hSynapsin1...pAAV-CAG-SomaGCaMP6f2 (AAV9) Plus, additional AAV serotypes of the most recent jGCaMP8 calcium sensors: pAAV-hSynapsin1...Retrograde) pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (AAV5)   There are hundreds of other biosensors in Addgene’s catalog...are generated by inserting a circularly-permuted GFP into an intracellular loop of various G-protein-coupled...small size (~1500 bp) makes iGECInano suitable for AAV packaging.    Find iGECInano plasmids here!   Matlashov...biosensors already in our collection have newly-available AAV preparations added this year. We’ve added new viral...
  4. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...TurboCas Enhancer-AAV viral preps targeting interneurons Glutamate indicators with increased sensitivity ...proteins, and stay tuned for mammalian expression and AAV plasmid sets launching later this year!  Find Addgene's...and labeled with primary antibody (0.01 µg/mL Anti-GFP [N86/38.1R] (Addgene #180084), 0.01 µg/mL Anti-HA...doi.org/10.1038/nbt.4201. Hot viral preps: Enhancer-AAVs targeting interneurons By Mike Lacy Targeting gene...factor for successful experiments or therapies. Using AAV vectors with enhancers that drive cell-type-specific...colleagues characterized a series of new enhancer-AAV vectors targeting specific classes of cortical and...et al., 2025).More than a dozen of these enhancer-AAV constructs are now available as in-stock viral preps...
  5. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ... from the default GFP (green) to RFP, CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a ...fluorescent protein genes, Cre recombination is required before fluorescence can occur. Cre recombinase can be...developing fish via Cre protein microinjection or crossing of Zebrabow animals to an inducible Cre line. The Schier...Tissue-specific Cre recombination in this mouse generates cells that randomly express either nuclear GFP, membrane...OFP (orange) (Livet et al., 2007). Brainbow uses a Cre/lox system to label neurons. Genes encoding the fluorescent...gene directly following the promoter is expressed. Cre-mediated deletion of one or several of these genes...system. One such system is Brainbow 2.0, which uses Cre to trigger the inversion of two genes aligned head-to-head...
  6. Recombinases AAV Preps

    Type
    Collection
    ...Service AAV Recombinases Viral Vector Packaging Service: Recombinases Cre AAV Dre AAV Flpo AAV Light-Inducible...107788 AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson 24593 AAV-pgk-Cre PGK none rg* Aebischer 51507 AAV pmSyn1...9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato Syn ...expression. See our Cre-lox Plasmids page for more information about these molecular tools. Cre AAV ID Name Promoter...* Deisseroth 55636 pAAV-EF1a-Cre EF1a none rg* Deisseroth 121675 pAAV-EF1a-fDIO-Cre EF1a none 1, 5, 8,...-Inducible Recombinases VCre AAV Browse the following tables for in-stock AAV preps that encode site-specific...Cepko 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre-4x6T GfaABC1D none ...
  7. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060...protein production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...fusing your protein to another protein, such as GFP, which allows you to visualize the cellular localization...Advantages Representative Empty Backbones AAV High transduction efficiency, but do NOT integrate...
  8. Hot Plasmids - February 2022

    Type
    Blog Post
    ...anti-FLAG-FB-GFP binding to FLAG-tag H2B for nuclear localization. (c) Applications of anti-FLAG-FB-GFP labeling...off-target effects, yet small enough to be packaged in AAV. A dCasMini-mediated adenine base editor allows for...expanded the genetic screening toolkit by optimizing a Cas12a-based method for screens. Cas12a’s ability ...underutilized in genetic screens because of its lowered editing rate. This research aimed to increase the potential...parallel. Lastly, this Cas12a-based screening method was used to create a genome-wide library capable of ...single cassette provides increased simplicity for combinatorial genetic screens, and this optimized toolkit...imaging of cellular targets Optimized genetic screening technique using Cas12a for multiplexed gene perturbation...
  9. Biosensor AAV Preps

    Type
    Collection
    ...element Activity Cre-dependent Flp-dependent Cre and Flp-dependent Cre, Flp, and VCre-dependent Constitutive...Packaging Service AAV Biosensors Viral Vector Packaging Service: Biosensor AAV Browse our AAV that express ...none Cre dependent 1, 5, 9, rg* GENIE 162382 pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE CAG jGCaMP8f none Cre dependent... none Cre dependent 1, 9, rg* GENIE 162380 pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE CAG jGCaMP8s none Cre dependent... none Cre dependent 1, 9, rg* GENIE 162381 pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE CAG jGCaMP8m none Cre-dependent... pGP-AAV-syn-FLEX-jGCaMP7s-WPRE Syn jGCaMP7s none Cre dependent 1, rg*, PHPeB Kim 104495 pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE...51083 AAV-EF1a-DIO-GCaMP6f-P2A-nls-dTomato EF1a GCaMP6f dTomato Cre dependent rg* Ting 51085 AAV-hSyn1...
  10. Retrovirus Plasmids

    Type
    Collection
    ...Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro...select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional...γ-Retrovirus Guide Biosafety Guide Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook γ-Retrovirus (gamma-retrovirus...Conditional overexpression plasmid; deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and...Plasmid for transgene expression; also expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional...
  11. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    .... Our new AAVs include: Optogenetics AAV Control AAV Biosensor AAV And more! Optogenetics Optogenetics...pGP-AAV-syn-jGCaMP7b-WPRE 104493 AAVrg pGP-AAV-syn-FLEX-jGCaMP7b-WPRE 104496 AAVrg pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE ...Overview of AAV Encoded Calcium Sensors). Plasmid Serotype Name 104489 AAVrg pGP-AAV-syn-jGCaMP7b-WPRE...some of the AAV we have released in the last few months. You can also browse our entire AAV inventory. ... control AAV in smaller aliquots of 20 ul for serotype testing to help you pick the best AAV for your ...26976 AAV5 pAAV-hSyn-hChR2(H134R)-mCherry 26973 AAVrg pAAV-hSyn-hChR2(H134R)-EYFP   Control AAV Control... 104495 AAVrg GP-AAV-CAG-FLEX-jGCaMP7s-WPRE 105714 AAV8 pAAV-Ef1a-fDIO-GCaMP6s Neurotransmitter ...
  12. Antibodies 101: Single Chain Fragment Variables (scFvs)

    Type
    Blog Post
    ...binding scFv that’s fused to GFP. When the multiple copies of the scFv-GFP fusion bind the SunTag scaffold...scFv that’s fused to a fluorescent protein such as GFP. The HA frankenbody works just like an antibody-based... allows for their delivery by viral vectors like AAV, which could be useful for delivering scFvs that ... rounds of screening. Created with Biorender.com.   Some phage display libraries screen antibody genes...serine with dispersed hydrophilic residues for increased solubility (Monnier et al., 2013). The linker ...expression systems. scFvs are also small enough to be screened for with in vitro display methods such as phage...applications where longer retention times often increase therapeutic efficacy (Ahmed et al., 2012). How...
  13. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ...brightly labeled with GFP (e.g. Thy1-YFP-H mice).  However, we recently developed AAV (adeno-associated virus...mouse brains expressing green fluorescent protein (GFP) (6).   The Dodt and Frank Bradke laboratories later... cranial nerve afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical...addition, there is a drop in image brightness with increasing depth caused by light scattering and absorption...
  14. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...    Figure 1: AAV toolkit for targeted gene delivery to the brain. The AAV (a) capsid, (b) cargo...Systemic capsids packaging Cre-dependent transgenes can also be paired with Cre-expressing transgenic mouse...precious cargo space in AAV vectors. Dual expression systems, which use two or more AAVs to transduce the same... et al, 2019 AAV-PHP.B2 CNS Mice Yes (LY6A) Deverman et al., 2016 AAV-PHP.B3 CNS Mice...2022 AAV-PHP.eC CNS: neurons and astrocytes Mice No (LY6C1) Shay et al., 2023 AAV-PHP.V1...al., 2020 AAV-PHP.N CNS: neurons Mice Yes (LY6A) Kumar et al., 2020 AAV-PHP.B4 CNS ...2023 AAV-F CNS: neurons and astrocytes Mice No (LY6C1)   Hanlon et al., 2019 AAV-BI-28 ...
  15. Luciferase Plasmid Collection

    Type
    Collection
    ...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...105538 pENN.AAV.TBG.PI.ffLuciferase.RBG Firefly TGB AAV expression of firefly luciferase and GFP James ...Description PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV9-CRISPR knockout...luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression of firefly luciferase Mark...Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly luciferase James Wilson...transfection Sidi Chen 118412 ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293 Firefly EF1α AAV expression of firefly luciferase...luciferase Paul Schulze-Lefert 83282 pAAV-CAG-RLuc Renilla CAG AAV expression of renilla luciferase Mark...
  16. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...pX601 61591 Mammalian/AAV BsaI yes, cut S. aureus Zhang pX602 61593 Mammalian/AAV BsaI yes, cut S. aureus...pyogenes Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...
  17. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...-positive assay) as well as stabilization (Nanog-GFP reporter activation and silencing of factor-linked...interneurons, Gordon Fishell’s lab has developed a new AAV approach using regulatory elements that restrict ...to this cell type. To this end, they constructed AAV plasmids bearing one of the distal-less homeobox ...these tools in virtually any vertebrate. This novel AAV approach allows you to target and functionally manipulate...tool for the research community. You can find the AAV vectors for infecting GABA-ergic interneurons here...27798629 Listen to Our Podcast Segment on This New AAV Tool    mCyRFP1: Novel fluorescent protein that...light-dependent Gal4 transcriptional activation and Cre recombination. Find PhoCl plasmids at Addgene. Zhang...
  18. PITChing MMEJ as an Alternative Route for Gene Editing

    Type
    Blog Post
    ... the GFP-Puro will be inserted just upstream of a stop codon. One potential concern is if the GFP-Puro...Chromosomes). Using their PITCh plasmids, GFP knock-in cell lines can be created in about a month and a half, without...detailed protocol for MMEJ-mediated knock-in of a GFP-Puro cassette into a given locus, just upstream of...microhomology to the insertion locus flanking the GFP-Puro cassette. Three double stranded breaks are necessary...necessary for knock-in: one on either side of the GFP-Puro cassette and one in between the 5’ and 3’ microhomologies...microhomologies (5’ and 3’) to anneal, knocking the GFP-Puro cassette into the locus (see figure below). ... overview of PITCh. The PITCh plasmid contains a GFP-Puro cassette flanked by 5' and 3' microhomology ...
  19. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    ... the supplied donor plasmid will express GFP. If there’s GFP expression, presumably the endogenous target...linked to an in-frame H2B-GFP. This visual read out allows for easy screening of different gRNAs by simply...RFP to GFP expressing cells provides a real-time read out of Cas9 activity.  By using the RFP:GFP ratio...Madison lab found that H2B-GFP expressing cells exhibited a 2-4 fold increase in the number of endogenous...in the genome) and an out-of-frame H2B (histone)-GFP reporter into the genome of mammalian cells.  ... can easily and seamlessly remove the integrated GFP reporter leaving you with just your desired genomic...14 and 21 to create GEmCherry2. The Denham lab made several other small changes creating 2 other versions...
  20. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...You may also like: Viral Service: All AAV Viviana Gradinaru PHP AAV Serotypes Blog: Viral Vectors As part...actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F) When using the AAV2(Y444F) serotype...We provide high quality AAV preps from select plasmids in the repository. Browse the University of Florida... Viral Vector Packaging Service AAV University of Florida Serotype Testing Panel for ...viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and (when possible) ...transduction of the mouse retina by tyrosine-mutant AAV serotype vectors. Mol Ther . 2009 Mar;17(3):463-71...One . Jun 8;10(6). PMID: 26052939 Lu, et al. 2016. AAV-mediated transduction and targeting of retinal bipolar...
  21. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent) High-performance...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...expression of GCaMP6m/s in cells depdent on Cre, Flp, or Vcre Comprehensive Dual- and Triple-Feature Intersectional...Localization Optogenetics Plasmids Viral Service: AAV Biosensors Fluorescent biosensors are proteins designed...associated with the article. We also offer ready-to-use AAV preparations of select plasmids; these are noted ...Genetically Encoded Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium...
  22. Plan Your Experiment

    Type
    Collection
    ...genome-wide screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector...vector and used to generate AAV particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive.../or gRNA Infects dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery...mutant allele of a gene ( point mutant )? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity. Dual-nickase approach increases specificity but is less ...
  23. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA (FUW-M2rtTA...viral titre to the number of cells transduced by a GFP encoded virus, and the reverse transcriptase activity...Viral Transductions Learn Why You Might Want to Use AAV in Your Research Lentiviral Vector Uses and Overview...lentiviral vector system. Viral vectors have been increasingly popular in fundamental and applied research ...replicate. However, Mother Nature found a way to re-create a functional virus. Indeed, by testing several ...the packaging plasmid forming a vector that could create replication competent virus. Even though this system...non-dividing cells and so researchers set out to create a better, safer system. Unlike the MoMLV, lentiviruses...
  24. Neurodegeneration Research Collection

    Type
    Collection
    ... Nat Biotechnol. 2023 May 22. See More AAV Viral Preps Find AAV viral preps for systemic delivery of viral...Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep useful for dopamine research. CBA-driven, Cre-dependent...research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies...Oct 18. Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ...blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons function...antibodies and scFvs for neuroscience research created with high-volume hybridoma sequencing on the NeuroMabSeq...
  25. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ... 74307 pAAV-CMV-DIO-Magneto2.0-sNRPpA AAV 74306 pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA AAV 74302 ..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...brain after delivering it via AAV injection, finding that it could increase the activity of neurons from...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...plasmids, which already includes dSaCas9-VPR in an AAV transfer vector for in-vivo expression and plasmids...
  26. Simplify Cloning with in vivo Assembly

    Type
    Blog Post
    ...mutation can be introduced in a gene, while adding a GFP-tag (Figure 3). Achieving multiple modifications...amplify! Examples of this are the GC-rich ITRs of AAV genomic DNA encoding plasmids, or promoters such ...assembly decreases as the cloning complexity increases. The efficiency of recombination is increased with ... minimize false positive colonies. We routinely screen just two colonies for simple cloning procedures...
  27. Tetracycline Inducible Expression

    Type
    Collection
    ...hairpin and GFP under pTREtight promoter None Either Elledge 35625 pAAV-Ptet-RFP-shR-rtTA AAV; shRNA cloning...option rtTA On Kowarz 16623 pBI-GFP Expression of your gene of interest & GFP from a bidirectional tet-responsive...Either Lung 11662 pPRIME-TET-GFP-FF3 Lentiviral, miRNA expression (PRIME) system for application in knockdown...Safe Harbor Locus. Tet-On 3G On Doyon 58245 pGLTR-X-GFP Single vector lentiviral Gateway RNAi system for ...generation; contains expression cassette for TetR-P2A-GFP; see article for additional constructs TetR On Geley...inducible promoter at its 3' end, which controls GFP expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...
  28. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...them advantageous for small capacity vectors like AAV. In addition to the mammalian option described below...plasmid contains all of the desired gRNAs. This increases the chance that all the edits you want to make... cleave outside of their recognition sequence, creating flanking overhangs. These overhangs can be customized...Expression Systems (MuLE) Kit: This kit can be used to create lentiviral vectors expressing wt humanized Cas9...the gRNAs. gRNAs are flanked by glycine tRNAs to create polycistronic glycine tRNA-gRNA (PTG) constructs...using 3 distinct spacer-repeats, you could easily create 7 unique arrays (e.g. for spacers A, B, and C, ...
  29. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A     ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...monoclonal antibodies against them, fused them to GFP, and compared them to popularly used epitopes tags...
  30. Adenovirus Guide

    Type
    Guide
    ...for replication. For more information about AAVs, read our AAV guide . Recombinant Adenoviral Vectors Wild-type...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses ...viruses that belong to the Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations...how they got their name, but they are not related. AAVs require the presence of adenoviral genes E1, E4,...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...throughout viral vector production. During experiments, GFP can be used to sort cells infected with rAdV vectors...
  31. Plan Your Experiment

    Type
    Guide
    ...genome-wide screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector...vector and used to generate AAV particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive.../or gRNA Infects dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery...mutant allele of a gene ( point mutant )? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity. Dual-nickase approach increases specificity but is less ...
  32. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  33. Hot Plasmids and Viral Preps - July 2021

    Type
    Blog Post
    ...of GCaMP8 AAV preps has expanded. Check out the new selection of ready-to-use AAV9 and AAVrg vectors. ...available in AAV8! Expand your imaging experiments with the Cre-OFF/FLP-ON vector 137128-AAV8: Ef1a-Coff...circularly permuted green fluorescent protein or cpGFP) to the petunia SL enzymatic receptor DAD2. SLs ...which modulates the fluorescence intensity of the cpGFP without altering that of the internal control (Fig...of biosensors could be used in high throughput screening for agrochemical compounds that have the potential...
  34. Hot Plasmids - October 2022

    Type
    Blog Post
    ... are currently available as Cre-dependent, EF1ɑ-driven viral vectors (AAV1) - and you can also find several...Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926. See the Applications...called JEDI-2P. Using a custom, high-throughput screening platform to apply saturating mutagenesis on 21... 1: Summary of the approach and outcomes of the screen for improved genetically-encoded voltage indicators... in-vivo imaging of voltage fluctuations. Image credit: Liu Z, et al. Cell. 2022.  Find JEDI-2p viral... Anti-c-Myc [9E10] page for more details. Image credit: Addgene.   Find anti-c-Myc antibody here! ...
  35. Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells

    Type
    Blog Post
    ...AdVs have already a packaging capacity larger than AAV vectors. This capacity is large enough to carry the... pAdSh.PGK.Cas9, pAdSh.U6.gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves says that advantages of AdVs include...templates in somatic cells of adult animals in order to create animal models for particular cancer. That’s exactly...the Memorial Sloan Kettering Cancer Center did to create a model of Eml4–Alk-driven lung cancer (Maddalo... Addgene and could be useful to labs wishing to create this kind of animal models. Start using adenoviral...guide RNA constructs, pAdSh.U6.gRNAS1 and pAdSh.U6.gRNAGFP, and also Adeno Cas9 and Adeno EA. Or if you're...Circ Res 115:488–492 . https://doi.org/10.1161/circresaha.115.304351 Holkers M, Maggio I, Henriques SFD...
  36. CRISPR Plasmids - Tagging

    Type
    Collection
    ...include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent..._CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human FLAG pFETCh_TGIF2...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ... lines were created using CRISPR and the donor plasmids containing homology arms and EGFP are available...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...
  37. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens...
  38. Minigenomes - a Safe Way to Study Dangerous Viruses Like the Ebola Virus

    Type
    Blog Post
    ...Plasmids Read Our Lentiviral Vector Guide Read Our AAV Guide  ...This post was contributed by guest blogger Tessa Cressey. The highly pathogenic Ebola virus belongs to the...non-viral) reporter gene (e.g. firefly luciferase or eGFP) flanked by the EBOV-specific gene start and gene...various viral components play in disease. Tessa Cressey is a PhD Student in the labs of Dr. Elke Mühlberger...
  39. Molecular Biology Reference

    Type
    Guide
    ...use these plasmids to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic...expanding viral service offers select ready-made AAV and lentiviral particles. Visit our viral service...study DNA fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids ... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...used in place of ampicillin. Preparing Antibiotics Create a stock solution of your antibiotic. Unless otherwise...
  40. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...in bacteria) such as lentiviral, retroviral, and AAV plasmids, we recommend the NEB Stable strain. For...process. To deposit plasmids online, you will need to create an account with Addgene before starting the process...plasmids, and adding all the plasmids at once increases the likelihood that the plasmids are given sequential...Please describe any tags or fusions (e.g. His, FLAG, EGFP, etc) on your insert. Use the drop-down menu to ...
  41. CRISPR Guide

    Type
    Guide
    .... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...
  42. CRISPR Guide

    Type
    Collection
    .... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...
  43. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ATP2A2-mEGFP AICSDP-41 mEGFP SERCA2 Sarcoplasmic...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...
Showing: 51 - 93 of 93 results