... to LanYFP and the addition of the enhanced GFP (EGFP)-type termini. mNeonGreen was reported as the brightest...protein. In vitro, mWasabi is 1.6-fold brighter than EGFP and is photostable. It also has narrow excitation...it does not significantly excite at 400 nm while EGFP does. Find mWasabi plasmids here! One of the most...

...IRES EGFP Chimeric channels for neuronal manipulation 119742  AAV5  AAV SYN PSAM4 GlyR IRES EGFP Chimeric...*  pAAV-CAG-GFP 50465  AAV8*, AAV9*  pAAV-hSyn-EGFP *Also coming in our new 20 ul trial size! Voltage...

...proteins for imaging with this set are mTagBFP2, EGFP or one of the improved GFP variants, mRuby2 or TagRFP-T...mammalian cells, one of the improved folding variants of EGFP like mEmerald or Clover is probably best; mNeonGreen...and have reported brightness measurements. Here, EGFP outperforms the improved folding variants, presumably...

...pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon Harvey 50457 AAV2 pAAV-hSyn-DIO-EGFP Bryan Roth 50459 AAV1 pAAV-hSyn-DIO-mCherry...pAAV-hSyn-DIO-mCherry Bryan Roth 50457 AAV1 pAAV-hSyn-DIO-EGFP Bryan Roth 114472 AAVrg pAAV-hSyn-mCherry Karl...

...receptor (EGFR) with the ClonTracer library and monitored population dynamics after treatment with EGFR inhibitor... in a study focusing on tumor cell resistance to EGFR inhibitor (Hata et al., 2016).  Bhang deposited ...

...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...Category Depositor  Notes pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics Yizhar...service with multiple serotypes pAAV_hSyn-PdCO-EGFP-WPRE AAV1, AAV5 Optogenetics Yizhar New viral service...

...(Plasmid 116771: pHAGE-PIK3CA) and EGFR (Plasmid 116731: pHAGE-EGFR), are represented in this collection...

.... Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin...destination vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...be conveniently performed through the N-terminal eGFP tag carried on all constructs.   pXPG: An alternative...

... Controls Edward Boyden New serotype pAAV-hSyn-EGFP AAV PHP.eB Controls Bryan Roth New serotype AiP13044...Controls Jonathan Ting New viral prep pAAV-CaMKIIa-EGFP AAV1 Controls Bryan Roth New serotype pAAV-Ef1a-DIO...

...real-time. The reporter constitutively expresses eGFP to indicate reporter abundance, and mCherry fluorescence...involves tracking the ratio of mCherry-positive to eGFP positive cells through fluorescence microscopy or...

... including those targeting EGFP, BRAF, and MAP3K4. The gRNAs targeting EGFP can be used as positive controls...

...caused by T cell migration.  CAR expression (or the eGFP proxy for CAR) is elevated at stable levels for ...      Fig. 2: Addgene’s western blot for mEGFP-HRas (from Plasmid 18662). See the Applications ...

...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...their 3 Opto-RTK constructs – Opto-mFGFR1, Opto-hEGFR, and Opto-hRET – as well as various LOV-domain-mVenus...

...nucleotides, such as the fluorescent proteins EGFP and mEGFP. Many of these features, such as Cas9, weren...

...This set of new anti-FLAG frankebodies includes mEGFP, mRuby2, iRFP713, SNAP-tag, and HaloTag fusions,...fusions, while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG...

...detect weak dimerization tendency, as is present in EGFP. Constantini et al, (2012) developed a cell-based... properties of new fusions can be compared with mEGFP or mTurquoise2, which are established true monomeric...

...targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE from Hongkui Zeng's lab...

...repair by non-homologous end joining (NHEJ) or HDR. EGFP validation of sgRNAs: Can evaluate component delivery...efficacy by cloning in genome target sequence into EGFP reporter. Target DNA reporter system: Can evaluate...

...pMAK463 (NBαMouse-IgK, Addgene #140701) pMAK464 (NBαEGFP, Addgene #140702) The pMAK461-64 plasmids were...introduced into the hPSC genome using AAV1 and contain an EGFP reporter. Expression of the dCas9-KRAB activator...