Skip to main content

We narrowed to 85 results for: Lox

Showing: 21 - 40 of 85 results
  1. Plasmids 101: The protein expression toolbox

    Type
    Blog Post
    ...good, the Cre-Lox system offers inducible yet permanent gene excision. Essentially, LoxP sites are knocked...time-tested system but does require knock-in of the LoxP sites, which is more difficult than a simple knock...out plasmids? Check out our Cre vector and Murine LoxP vector.   Turn it off for a little while Transient...
  2. Common Injection Routes in Mice

    Type
    Blog Post
    ...Engineering Guide CRISPR Mammalian Expression plasmids Cre-Lox plasmids References Prathipati, P., Rodriguez-Aguayo...
  3. Rabies and Neuronal Tracing

    Type
    Blog Post
    ...Delivery to the CNS and PNS Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist's View Control Gene...
  4. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060 ...including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression miRNA and 3' UTR ...
  5. Lentivirus Plasmids

    Type
    Collection
    ...selection. Wiederschain 11578 pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns...turns on shRNA expression. See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP...
  6. Plasmid Collections

    Type
    Collection
    ...Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent Proteins...
  7. Validated gRNA Sequences

    Type
    Collection
    ...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S...
  8. Mammalian RNAi Tools

    Type
    Collection
    ...as well as those that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To ...
  9. E11 Bio PRISM Collection

    Type
    Collection
    ...at Addgene: AAV Packaged on Request AAV Guide Cre-Lox Plasmid Collection Content last reviewed: 5 September...
  10. Recombinases AAV Preps

    Type
    Collection
    ... be used to control gene expression. See our Cre-lox Plasmids page for more information about these molecular...
  11. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ... safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same as ...transgenes that are flanked by loxP sites. While there is only a small loxP scar behind at the site of excision...
  12. Optogenetics Guide

    Type
    Guide
    ...with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in a genetically...cells. For example, using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression...
Showing: 21 - 40 of 85 results