We narrowed to 85 results for: Lox
-
TypeBlog Post...in CRISPR genome editing. 2. Plasmids 101: Cre-lox Cre recombinase can be used to generate inversions...
-
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post... Cre/lox recombination system. A researcher can flank fluorescent proteins in a plasmid with loxP sites...respectively. The permanent labelling of cells using cre-lox is advantageous when compared to photoactivable or... -
A Novice's Perspective on Neuroscience - SfN2017
TypeBlog Post...Resources on the Addgene Blog Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist's View Interview: ... -
Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS
TypeBlog Post...expression systems exist (eg. LexA/LexAop and Cre/Lox systems) in case you want to express one gene in ... -
Plasmids 101: The protein expression toolbox
TypeBlog Post...good, the Cre-Lox system offers inducible yet permanent gene excision. Essentially, LoxP sites are knocked...time-tested system but does require knock-in of the LoxP sites, which is more difficult than a simple knock...out plasmids? Check out our Cre vector and Murine LoxP vector. Turn it off for a little while Transient... -
Lighting Up Cell Signaling with Photoswitchable Kinases
TypeBlog Post...Fluorescent Proteins Control Protein Expression with Cre-lox Control Protein Activity with GFP Resources at Addgene.org... -
Quickest Way to Deposit Plasmids: The Deposit Spreadsheet
TypeBlog Post...lentiviral, retroviral, AAV, RNAi, luciferase, cre/lox, yeast expression, worm expression, insect expression... -
Common Injection Routes in Mice
TypeBlog Post...Engineering Guide CRISPR Mammalian Expression plasmids Cre-Lox plasmids References Prathipati, P., Rodriguez-Aguayo... -
Rabies and Neuronal Tracing
TypeBlog Post...Delivery to the CNS and PNS Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist's View Control Gene... -
Quick Guide to Working with Drosophila Part 1: Getting Started with Flies
TypeBlog Post...Specific Recombination in Drosophila Learn about Cre-Lox Resources on Addgene.org Find Drosophila Plamids... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...orange) (Livet et al., 2007). Brainbow uses a Cre/lox system to label neurons. Genes encoding the fluorescent...Brainbow 2.1 construct in the Rosa26 locus, under a loxP “roadblock” so that XFP are only expressed following... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060 ...including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression miRNA and 3' UTR ... -
Lentivirus Plasmids
TypeCollection...selection. Wiederschain 11578 pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns...turns on shRNA expression. See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP... -
Plasmid Collections
TypeCollection...Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent Proteins... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
Mammalian RNAi Tools
TypeCollection...as well as those that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To ... -
E11 Bio PRISM Collection
TypeCollection...at Addgene: AAV Packaged on Request AAV Guide Cre-Lox Plasmid Collection Content last reviewed: 5 September... -
Recombinases AAV Preps
TypeCollection... be used to control gene expression. See our Cre-lox Plasmids page for more information about these molecular... -
Delivery Methods for Generating iPSCs
TypeBlog Post... safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same as ...transgenes that are flanked by loxP sites. While there is only a small loxP scar behind at the site of excision... -
Optogenetics Guide
TypeGuide...with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in a genetically...cells. For example, using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression...