We narrowed to 55 results for: MSC;

...the other hand, mScarlet-I shows correct ER labeling, which is good evidence that mScarlet-I acts as a monomer...

..., MMLV, MuLV, or MLV) or Murine Stem Cell Virus (MSCV) genomes whereas lentiviral vectors are derived ...retroviral plasmids (based on the Murine Stem Cell Virus, MSCV) each with a unique 6 nucleotide barcode. This collection...

...ShadowR is used as a FRET acceptor to mRuby2 or mScarlet. Image: Murakoshi et al., 2019. ShadowR is ... a FRET acceptor in combination with mRuby2 or mScarlet as the donor in HeLa cells.   Find ShadowR for...

...proteins that had shown magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random...semi-random mutagenesis and screening, the EGFP and mScarlet variants were showing no obvious signs of improved...

... Figure 4: Reporters in Gene On include a mScarlet reporter, luciferase reporter, and neomycin resistance...translation of an array of different reporters including mScarlet-I, luciferase, antibiotic resistance markers, ...

...cells include: mTurquoise2, mEGFP, mNeonGreen, mScarlet(-I), and mCherry. Keep the linker sequence short...instance, Lifeact-mTurquoise2 (Plasmid #36201) or mScarlet-tubulin (Plasmid #85045). We often use restriction...

...fluorescent proteins, PinkyCaMP is the first based on mScarlet. Compared to RCaMP3 and jRGECO1a, PinkyCaMP had...Fink, R., Imai, S., et al. (2024). PinkyCaMP a mScarlet-based calcium sensor with exceptional brightness...

...the example at right using blue flame plasmid pmScarlet_C1! After creating the T7-DNA template, you'd use...right homology arm to the desired insert (e.g., mScarlet).   Plasmid ID Plasmid Name Tags ...

...lacZ gene Reverse MSCV Forward CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC...PGK promoter Forward MSCV CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC...Forward pLXSN 5' (MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F...

...Jordane Dimidschstein New serotype pAAV_hSyn-PdCO-mScarlet-WPRE AAV1 Optogenetics Ofer Yizhar New viral ...

...References and Resources References Romano E, Baumschlager A, Akmeriç EB, Palanisamy N, Houmani M, Schmidt...

...Deisseroth New viral prep pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE AAVrg Optogenetics Ofer Yizhar New serotype...

...WPRE-SV40 124650 AAV9 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 55645 AAV5 pAAV-hSyn Con/Fon hChR2(H134R...

...Serotype Name 124651  AAV9  pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603  AAV9  pAAV-EF1a-DIO-ChrimsonR-...

...near the target site.” pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 (124651-AAV9) Recombinase AAV Targeting...

...overlapping methylation Not affected Not affected MscI Not affected Blocked by overlapping methylation ...

...Libraries are available with T-Sapphire, EGFP, or mScarlet reporters, so you can choose a color compatible...

...PMCID: PMC3074624. 5. Bindels, Daphne S., et al. "mScarlet: a bright monomeric red fluorescent protein for...

...markers tagged with mTurquoise2, mNeonGreen, and mScarlet-I for labeling a list of specific structures within...

...the use of bright red fluorescent proteins (e.g. mScarlet) or infrared fluorescent proteins (Chernov et ...