Skip to main content

We narrowed to 57 results for: Msc

Showing: 21 - 40 of 57 results
  1. Viral Vectors 101: Gamma-Retroviral Packaging Systems

    Type
    Blog Post
    ...derived from MoMLV (Moloney Murine Leukemia Virus) or MSCV (Murine Stem Cell Virus) sequences. Packaging genes...viruses were derived from different genomes (MoMLV and MSCV for γ-retrovirus; HIV for lentivirus). Additionally...
  2. Magnetic Control of Proteins: More than a Dream

    Type
    Blog Post
    ...proteins that had shown magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random...semi-random mutagenesis and screening, the EGFP and mScarlet variants were showing no obvious signs of improved...
  3. Hot Plasmids: Fall 2025

    Type
    Blog Post
    ...fluorescent proteins, PinkyCaMP is the first based on mScarlet. Compared to RCaMP3 and jRGECO1a, PinkyCaMP had...Fink, R., Imai, S., et al. (2024). PinkyCaMP a mScarlet-based calcium sensor with exceptional brightness...
  4. Sequencing Primers

    Type
    Guide
    ...lacZ gene Reverse MSCV Forward CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC...PGK promoter Forward MSCV CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC...Forward pLXSN 5' (MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F...
  5. New Viral Vectors - Spring 2025

    Type
    Blog Post
    ...Jordane Dimidschstein New serotype pAAV_hSyn-PdCO-mScarlet-WPRE AAV1 Optogenetics Ofer Yizhar New viral ...
  6. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...Deisseroth New viral prep pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE AAVrg Optogenetics Ofer Yizhar New serotype...
  7. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ...Libraries are available with T-Sapphire, EGFP, or mScarlet reporters, so you can choose a color compatible...
  8. Hot Plasmids - August 2020

    Type
    Blog Post
    ...markers tagged with mTurquoise2, mNeonGreen, and mScarlet-I for labeling a list of specific structures within...
Showing: 21 - 40 of 57 results