We narrowed to 54 results for: Msc

1. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

   Type

   Blog Post

   ...the other hand, mScarlet-I shows correct ER labeling, which is good evidence that mScarlet-I acts as a monomer...

2. Popular Retroviral Vectors and Their Uses in Scientific Research

   Type

   Blog Post

   ..., MMLV, MuLV, or MLV) or Murine Stem Cell Virus (MSCV) genomes whereas lentiviral vectors are derived ...retroviral plasmids (based on the Murine Stem Cell Virus, MSCV) each with a unique 6 nucleotide barcode. This collection...

3. Magnetic Control of Proteins: More than a Dream

   Type

   Blog Post

   ...proteins that had shown magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random...semi-random mutagenesis and screening, the EGFP and mScarlet variants were showing no obvious signs of improved...

4. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

   Type

   Blog Post

   ...ShadowR is used as a FRET acceptor to mRuby2 or mScarlet. Image: Murakoshi et al., 2019. ShadowR is ... a FRET acceptor in combination with mRuby2 or mScarlet as the donor in HeLa cells.   Find ShadowR for...

5. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

   Type

   Blog Post

   ... Figure 4: Reporters in Gene On include a mScarlet reporter, luciferase reporter, and neomycin resistance...translation of an array of different reporters including mScarlet-I, luciferase, antibiotic resistance markers, ...

6. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

   Type

   Blog Post

   ...cells include: mTurquoise2, mEGFP, mNeonGreen, mScarlet(-I), and mCherry. Keep the linker sequence short...instance, Lifeact-mTurquoise2 (Plasmid #36201) or mScarlet-tubulin (Plasmid #85045). We often use restriction...

7. Easi-CRISPR: Generating Knock-In and Conditional Mouse Models

   Type

   Blog Post

   ...the example at right using blue flame plasmid pmScarlet_C1! After creating the T7-DNA template, you'd use...right homology arm to the desired insert (e.g., mScarlet).   Plasmid ID Plasmid Name Tags ...

8. New Viral Vectors - Spring 2025

   Type

   Blog Post

   ...Jordane Dimidschstein New serotype pAAV_hSyn-PdCO-mScarlet-WPRE AAV1 Optogenetics Ofer Yizhar New viral ...

9. Sequencing Primers

   Type

   Guide

   ...primer MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine ...

10. New Viral Vectors - Winter 2025

    Type

    Blog Post

    ...Deisseroth New viral prep pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE AAVrg Optogenetics Ofer Yizhar New serotype...

11. New and Upcoming Viral Vectors - December 2019

    Type

    Blog Post

    ...WPRE-SV40 124650 AAV9 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 55645 AAV5 pAAV-hSyn Con/Fon hChR2(H134R...

12. A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light

    Type

    Blog Post

    ...References and Resources References Romano E, Baumschlager A, Akmeriç EB, Palanisamy N, Houmani M, Schmidt...

13. New and Upcoming Viral Vectors - June 2019

    Type

    Blog Post

    ...Serotype Name 124651  AAV9  pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603  AAV9  pAAV-EF1a-DIO-ChrimsonR-...

14. New and Upcoming Viral Vectors - September 2019

    Type

    Blog Post

    ...near the target site.” pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 (124651-AAV9) Recombinase AAV Targeting...

15. Plasmids 101: Methylation and Restriction Enzymes

    Type

    Blog Post

    ...overlapping methylation Not affected Not affected MscI Not affected Blocked by overlapping methylation ...

16. Hot Plasmids: Summer 2025

    Type

    Blog Post

    ...Libraries are available with T-Sapphire, EGFP, or mScarlet reporters, so you can choose a color compatible...

17. Fluorescent Proteins 101: Visualizing Subcellular Structures & Organelles

    Type

    Blog Post

    ...PMCID: PMC3074624. 5. Bindels, Daphne S., et al. "mScarlet: a bright monomeric red fluorescent protein for...

18. Hot Plasmids - August 2020

    Type

    Blog Post

    ...markers tagged with mTurquoise2, mNeonGreen, and mScarlet-I for labeling a list of specific structures within...

19. Fluorescent Proteins 101: When GFP lets you down

    Type

    Blog Post

    ...the use of bright red fluorescent proteins (e.g. mScarlet) or infrared fluorescent proteins (Chernov et ...

20. Fluorescent Protein Guide: Subcellular Localization

    Type

    Collection

    ... Gadella 85053 pmScarlet-i_H2A_C1 Nucleus H2A mScarlet-I Dorus Gadella 85052 pmScarlet-H_H2A_C1 Nucleus...Nucleus H2A mScarlet-H Dorus Gadella 85051 pmScarlet_H2A_C1 Nucleus H2A mScarlet Dorus Gadella 18982 pHIV-...Bruchez 85065 pmScarlet-I_peroxisome_C1 Peroxisome SRL mScarlet-I Dorus Gadella 85064 pmScarlet-H_peroxisome_C1...Peroxisome SRL mScarlet-H Dorus Gadella 85063 pmScarlet_peroxisome_C1 Peroxisome SRL mScarlet Dorus Gadella...85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet Dorus Gadella 85046 pmScarlet-H_alphaTubulin_C1...alpha-tubulin mScarlet-H Dorus Gadella 85047 pmScarlet-i_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet-I Dorus...85054 pLifeAct_mScarlet_N1 Actin Filaments LifeAct mScarlet Dorus Gadella 85055 pLifeAct_mScarlet-H_N1 ...