Skip to main content

We narrowed to 93 results for: c myc

Showing: 21 - 40 of 93 results
  1. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...j.cell.2021.09.018 Choi, J., Chen, W., Suiter, C. C., Lee, C., Chardon, F. M., Yang, W., Leith, A., Daza,...expression ~ ~ ~ ~ ✓   ✓ SV40 and c-Myc nuclear localization sequences Improve translocation..., J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson, D., Zhao, A.,...Leukemia Virus (M-MLV) reverse transcriptase to the C-terminus of Cas9 H840A nickase (PE1). But innovations...pegRNAs (Yan et al., 2024). The team fused La to the C-terminal end of PEmax to produce PE7. PE7 significantly...References Anzalone, A. V., Gao, X. D., Podracky, C. J., Nelson, A. T., Koblan, L. W., Raguram, A., Levy... Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G. A., Raguram, A., & Liu, D. R. (2019). ...
  2. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...(3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if HDR completely failed. If C-terminus...Kalantzaki M, Gangoso E, Matjusaitis M, Garcia-Diaz C, Blin C, Grant V, Bulstrode H, Gogolok S et al. 2017. ...available for human and mouse genomes only and deals with C-terminus epitope tagging. If you work with other model...your crRNAs using other web-based design tools (for C-terminus tagging, pick a crRNA that cuts 8-15 bp downstream...insertion site (within ~8-15 bp from the stop codon for C-terminus tagging) GC content of the crRNA (aim for... O'Duibhir E, Quinn N, Tyrer A, Leitner MC, Plumb C, Kalantzaki M et al. 2018. An efficient and scalable...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal Fifrefly luciferase fragment for split-luciferase...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Luminopsins : Luciferase-opsin...FRB-Nluc : Split firefly luciferase reporter of rapamycin-inducible interaction. nLuc and cLuc : Constructs...
  4. Hot Plasmids February 2024

    Type
    Blog Post
    ...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...mChe), with co-incubation with assist peptide (AP). C) Workflow for Cas-RNP-PAGE editing of primary T cells...
  5. Neuronal labeling with Spaghetti Monster

    Type
    Blog Post
    ...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic...pdb-top63. PubMed PMID: 20150100. 4. Shaner, Nathan C., George H. Patterson, and Michael W. Davidson. "Advances...
  6. How to Write a Scientific Review Article

    Type
    Blog Post
    ... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...perfect. Good luck! References 1. Haery, Leila, Ryan C. Thompson, and Thomas D. Gilmore. "Histone acetyltransferases...
  7. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...an n-terminal DNA recognition domain and a mostly c-terminal nuclease domain. Feng Zhang's group utilized...genes using dCas9-VP64 activator fragments (dCas9(C)-FKBP-2xNLS-VP64 and dCas9(N)-FRB-NES). This system...
  8. Tetracycline Inducible Expression

    Type
    Collection
    ...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...
  9. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...genome engineering methods for C. elegans were released, signaling a new era in C. elegans research. Homology...of custom genomic modifications, is very robust in C. elegans, and the methods for HDR-mediated modification...the University of North Carolina has made CRISPR in C. elegans even easier - now, one can generate a fluorescent...-based gene tagging approach Multiple features of C. elegans have made CRISPR/Cas9 so successful in this...previously used a transgene selection strategy for their C. elegans/CRISPR experiments, but this strategy required... make it possible fluorescently label proteins in C. elegans, they inserted the SEC into a synthetic intron...system is both simple to use and highly efficient for C. elegans genome modification. Figure 2: Schematic...
  10. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene disruption in M. abscessus...tagging proteins, as it can be fused to the N- or C-terminus (or even in the middle of proteins) and performs.... E., Young, D. F., Goswami, K. K., & Russell, W. C. (1987). Isolation and characterization of monoclonal...39406745. Optimizing mScarlet tags for live imaging in C. elegans By Alyssa Neuhaus Red fluorescent proteins...maturation rate limits its use in systems like the C. elegans embryo, where developmental processes happen...recently generated new constructs specifically for C. elegans (Cao et al., 2024). The team designed coding...mScarlet3 and mScarlet-I3 that were codon-optimized for C. elegans and included artificial introns to improve...
  11. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting...tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol...streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen’s lab from the University...paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive channel). ...Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM, Chodera JD. bioRxiv preprint...pharmaceutical industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production...
  12. CRISPR 101: Cytosine Transversion Editors

    Type
    Blog Post
    ...transversions C → TG → A A → GT → C C → G                   C → AG → C                   G → T A → C                   ...Rosser, S. J., Bi, C., & Zhang, X. (2021). Glycosylase base editors enable C-to-A and C-to-G base changes...deaminase could also perform cytidine (C) deamination, converting the C base to uracil (U). This is the same...given the pithier name CGBE1, for “C → G Base Editor 1,” and had a C → G editing efficiency of up to 68%...Beyond UNG: Optimizing C → G editors Now that several labs had shown that preferential C → G editing was possible...pyrimidines (C ↔ T).   Base transversion  Base changes from purine (A or G) to pyrimidine (C or T) or vice-versa...type of base editor invented. CGBE C → G Base Editor Converts C → G; also called a glycosylase base ...
  13. Sequencing Primers

    Type
    Guide
    ... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ...transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of...elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of ...primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...
  14. Five Popular Model Organisms

    Type
    Blog Post
    ...an ortholog in C. elegans making it ideal to study basic molecular biology processes. C. elegans are also...PMCID: PMC5525645. Mello, Craig C., et al. "Efficient gene transfer in C. elegans: extrachromosomal maintenance...lab to study neuronal development (Brenner, 1973). C. elegans are small, transparent worms that have a ...life cycle and large brood sizes. The majority of C. elegans are also self-fertile hermaphrodites making... Nobel Prize in 2006. One of  major advantages of C. elegans is that they are transparent throughout their...GCaMP6 (Nguyen et al., 2015). If you are interested in C. elegans plasmids and resources check out Addgene’... of the fly (Pfeiffer et al., 2010). Yeast (Saccharomyces cerevisiae) Yeast, one of the simplest eukaryotic...
  15. Viral Production at Addgene

    Type
    Blog Post
    ...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...preparations are then aliquoted, frozen, and stored at -80 °C. Concentrated lentiviral preparations (“-LVC” catalog..., and is routinely tested for mycoplasma contamination using mycoplasma detection kits. Cell line is maintained... tested for mycoplasma contamination. To date, Addgene has never had a case of mycoplasma contamination...normalization purposes are being used. Quality Control Mycoplasma Our 293T cell line was obtained directly from...
  16. Bacterial Expression Systems

    Type
    Collection
    ...peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed) BiFC Jens...coli Cynthia Collins 112197 pANY3 Temperature (42 °C) Escherichia coli Yingfeng An Other Addgene Controlled...Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Vinay...Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter... PnitA-NitR ε-caprolactam Escherichia coli , Streptomyces sp. Xuming Mao 46888 pMSP3545 PnisA Nisin Escherichia...
  17. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...3rd 4 78,637 Broad GPP Humagne Set C and Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition...
  18. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    ...jcm.23.5.959-961.1986 Lobstein, J., Emrich, C. A., Jeans, C., Faulkner, M., Riggs, P., & Berkmen, M. (2012...References Hwang, J. M., Piccinini, T. E., Lammel, C. J., Hadley, W. K., & Brooks, G. F. (1986). Effect...Slow transformation   Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis.... Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability (streptomycin), doesn’t work for... for transformations. Con: Expensive.   Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits...Like carb, spectinomycin is the more stable and expensive antibiotic compared to streptomycin. Spectinomycin...Spectinomycin/streptomycin can be successfully used for plant and bacterial culture, but some types of bacteria...
  19. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ...difficult to grow. Growth Temp Choose from 30 °C, 37 °C, or room temperature. Growth Strain Please...frog), D. rerio (zebrafish), D. melanogaster (fly), C. elegans (nematode), S. cerevisiae (budding yeast)... gentamicin, hygromycin, kanamycin, nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline...maintain a glycerol stock. Choose from: ampicillin, apramycin, blasticidin, bleocin (zeocin), chloramphenicol...
Showing: 21 - 40 of 93 results