We narrowed to 26 results for: c myc vectors

... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...expression vector which gives close to 100% cloning efficiency and gene expression. The pUCXKT vector ensures...different N- and C-terminal tags. Additionally, by using an adapted destination vector with a heterologous...science.aaa3380 MuLE vectors for customized lentivirus production Finding a lentiviral vector backbone with ...custom-cloned vectors in a Multisite Gateway reaction with a desired destination vector expressing a separate...a final lentiviral vector containing up to 5 different elements. Lentiviral vectors constructed with the...

...plasmid. A single vector approach may not have as much flexibility and control as a dual vector design, but ...popular empty backbones, expression vectors for transactivators, and vectors for other applications, or search...Lentiviral Tet-Off vector for repressible expression with blasticidin selection. *Note: this vector contains an...120309 pAAV-FAH-rtTA3G AAV vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G ...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...respectively. You should also choose between: Dual vector system: express the transactivator and the tet-...-controlled gene of interest from two separate vectors. Stable cell lines or transgenic animals can be...

... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting... interest and cloned into provided destination vectors using low-cost, one-pot golden gate cloning that...

...peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed) BiFC Jens...selection of mammalian and bacterial FRET-related vectors and standards. The Hoschschild Bacterial Two-Hybrid...FRET-based Biosensors Kit (Addgene #1000000021) is a vector library for the generation of FRET biosensors for...#1000000222) is a collection of Golden Gate compatible vectors for bimolecular fluorescence complementation experiments...coli Cynthia Collins 112197 pANY3 Temperature (42 °C) Escherichia coli Yingfeng An Additional Addgene Controlled...

... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...thymine, cytosine, and guanine (abbreviated to A, T, C, and G, respectively). The bases are organized into... hydrogen bonds, where A always pairs with T, and C always pairs with G. The order of nucleotides makes...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...