We narrowed to 35 results for: c-myc

...Zhi Ying Chen, Robert C. Robbins, Mark A. Kay, Michael T. Longaker, and Joseph C. Wu. "A nonviral minicircle... viral particles that express oncogenes, such as Myc. Viral vectors also have the largest genomic footprint...transgenes is a concern as well, and reactivation of Myc or other oncogenes after differentiation has been...a Sendai Virus-Based Vector Using a Nonstructural C Protein and Endogenous MicroRNAs." Plos One 11, no...including reporters and RNAi) for:  NANOG  OCT4 SOX2 MYC KLF4 LIN28 Check out these plasmids if you’re interested...

... expression systems that can be added to the N or C terminus of your protein of interest. Many of these...different types of tags, including epitope tags (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry...

...PCR or by evaluating visual phenotypes. Improving C. elegans fluorescent protein tagging with SapTrap ...called SapTrap to improve CRISPR genomic tagging in C. elegans. SapTrap offers scientists a convenient one...protein tagging systems For those who do not work with C. elegans, several groups have designed modular toolkits...by the Hornung Lab, allows users to easily create C-terminal tag fusions of endogenous genes in human ... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...plasmid containing the homology arms and an N- or C-terminal tag. The two PCR reactions are then mixed...line stably expressing Cas9. This PCR toolkit offers C- and N-terminal tagging vectors (eg GFP, Flag, YFP...

...sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, Myc). These constructs include...

...peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed) BiFC Jens...coli Cynthia Collins 112197 pANY3 Temperature (42 °C) Escherichia coli Yingfeng An Additional Addgene Controlled...

...expressing iGluSnFR3, iGluSnFR4f, and iGluSnFR4s. C) Spike-triggered averages for single action potential-evoked...tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable: A puromycin...integrase-based approaches. Find STITCHR plasmids here! Fell, C. W., Villiger, L., Lim, J., Hiraizumi, M., … Abudayyeh...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein... Cenik, B. K., Aoi, Y., Iwanaszko, M., Howard, B. C., Morgan, M. A., Andersen, G. D., Bartom, E. T., &.../doi.org/10.1016/j.molcel.2024.11.007. Branon, T. C., Bosch, J. A., Sanchez, A. D., Udeshi, N. D., Svinkina...and PV-positive cells out of all BiPVe3-dTom cells. C) Confocal stack of a biocytin-filled cell expressing...

...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...mChe), with co-incubation with assist peptide (AP). C) Workflow for Cas-RNP-PAGE editing of primary T cells...

...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic...pdb-top63. PubMed PMID: 20150100. 4. Shaner, Nathan C., George H. Patterson, and Michael W. Davidson. "Advances...

... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...perfect. Good luck! References 1. Haery, Leila, Ryan C. Thompson, and Thomas D. Gilmore. "Histone acetyltransferases...

...(3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if HDR completely failed. If C-terminus...Kalantzaki M, Gangoso E, Matjusaitis M, Garcia-Diaz C, Blin C, Grant V, Bulstrode H, Gogolok S et al. 2017. ...available for human and mouse genomes only and deals with C-terminus epitope tagging. If you work with other model...your crRNAs using other web-based design tools (for C-terminus tagging, pick a crRNA that cuts 8-15 bp downstream...insertion site (within ~8-15 bp from the stop codon for C-terminus tagging) GC content of the crRNA (aim for... O'Duibhir E, Quinn N, Tyrer A, Leitner MC, Plumb C, Kalantzaki M et al. 2018. An efficient and scalable...

...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...

... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...an n-terminal DNA recognition domain and a mostly c-terminal nuclease domain. Feng Zhang's group utilized...Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and net influx into the nucleus...genes using dCas9-VP64 activator fragments (dCas9(C)-FKBP-2xNLS-VP64 and dCas9(N)-FRB-NES). This system...constructing fusion proteins with customizable N- and C-terminal modules   Thanks to the lab of Tomás Santalucía...specific expression containing a variety of N- and C- terminal tags. The Santalucía Lab has developed a...

...CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT...CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3' end of DsRed1 Forward ... Human elongation factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...

... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting...tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol...streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen’s lab from the University...paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive channel). ...Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM, Chodera JD. bioRxiv preprint...

... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...thymine, cytosine, and guanine (abbreviated to A, T, C, and G, respectively). The bases are organized into... hydrogen bonds, where A always pairs with T, and C always pairs with G. The order of nucleotides makes...vitro DNA replication in addition to the normal A, T, C, or G nucleotides. The four standard bases (dNTPs)...emitted each time a base is added. Again, each base (A,C,T, or G) is labeled with a different color, making...