We narrowed to 41 results for: c-myc

...of transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic...article have been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...fluorophores with nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, ...coselection, analogous to methods previously used in C. elegans, targets the sodium/potassium pump ATP1A1...

...sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, Myc). These constructs include...

... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...PCR or by evaluating visual phenotypes. Improving C. elegans fluorescent protein tagging with SapTrap ...called SapTrap to improve CRISPR genomic tagging in C. elegans. SapTrap offers scientists a convenient one...protein tagging systems For those who do not work with C. elegans, several groups have designed modular toolkits...by the Hornung Lab, allows users to easily create C-terminal tag fusions of endogenous genes in human ...plasmid containing the homology arms and an N- or C-terminal tag. The two PCR reactions are then mixed...line stably expressing Cas9. This PCR toolkit offers C- and N-terminal tagging vectors (eg GFP, Flag, YFP...

...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...mChe), with co-incubation with assist peptide (AP). C) Workflow for Cas-RNP-PAGE editing of primary T cells...

...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo...Renilla Ubc Lentiviral Expression of Renilla luciferase Rudolf Jaenisch 113450 pLenti NL NanoLuc® Ubc Lentiviral...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal Fifrefly luciferase fragment for split-luciferase...Christopher Vakoc 33307 Ubc.Luc.IRES.Puro Firefly Ubc Lentiviral expression of firefly luciferase Linzhao...

... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...perfect. Good luck! References 1. Haery, Leila, Ryan C. Thompson, and Thomas D. Gilmore. "Histone acetyltransferases...

...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic...pdb-top63. PubMed PMID: 20150100. 4. Shaner, Nathan C., George H. Patterson, and Michael W. Davidson. "Advances...

... mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5)...

...expression ~ ~ ~ ~ ✓   ✓ SV40 and c-Myc nuclear localization sequences Improve translocation...j.cell.2021.09.018 Choi, J., Chen, W., Suiter, C. C., Lee, C., Chardon, F. M., Yang, W., Leith, A., Daza,..., J., Oyler-Castrillo, P., Ravisankar, P., Ward, C. C., Levesque, S., Jing, Y., Simpson, D., Zhao, A.,...Leukemia Virus (M-MLV) reverse transcriptase to the C-terminus of Cas9 H840A nickase (PE1). But innovations...pegRNAs (Yan et al., 2024). The team fused La to the C-terminal end of PEmax to produce PE7. PE7 significantly...References Anzalone, A. V., Gao, X. D., Podracky, C. J., Nelson, A. T., Koblan, L. W., Raguram, A., Levy... Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G. A., Raguram, A., & Liu, D. R. (2019). ...

...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...expressing iGluSnFR3, iGluSnFR4f, and iGluSnFR4s. C) Spike-triggered averages for single action potential-evoked...tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable: A puromycin...integrase-based approaches. Find STITCHR plasmids here! Fell, C. W., Villiger, L., Lim, J., Hiraizumi, M., … Abudayyeh... Cenik, B. K., Aoi, Y., Iwanaszko, M., Howard, B. C., Morgan, M. A., Andersen, G. D., Bartom, E. T., &.../doi.org/10.1016/j.molcel.2024.11.007. Branon, T. C., Bosch, J. A., Sanchez, A. D., Udeshi, N. D., Svinkina...and PV-positive cells out of all BiPVe3-dTom cells. C) Confocal stack of a biocytin-filled cell expressing...

...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting...

...(3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if HDR completely failed. If C-terminus...Kalantzaki M, Gangoso E, Matjusaitis M, Garcia-Diaz C, Blin C, Grant V, Bulstrode H, Gogolok S et al. 2017. ...available for human and mouse genomes only and deals with C-terminus epitope tagging. If you work with other model...your crRNAs using other web-based design tools (for C-terminus tagging, pick a crRNA that cuts 8-15 bp downstream...insertion site (within ~8-15 bp from the stop codon for C-terminus tagging) GC content of the crRNA (aim for... O'Duibhir E, Quinn N, Tyrer A, Leitner MC, Plumb C, Kalantzaki M et al. 2018. An efficient and scalable...

...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ...FUW-M2rtTA Lentiviral Tet-On vector, expressing rtTA from UbC promoter rtTA-Advanced Rudolf Jaenisch 25434 pMA2640... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...

...Sci Transl Med. 2013) Express human DNMT1 with a Myc tag. (Li et al. J Biol Chem. 2006) Express human ATM... constructs: pLVX-UbC-rtTA-Ngn2:2A:EGFP (Schafer et al. Nat Neurosci. 2019) pLVX-UbC-rtTA-Ngn2:2A:Ascl1...

...either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 ...

...peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed) BiFC Jens...coli Cynthia Collins 112197 pANY3 Temperature (42 °C) Escherichia coli Yingfeng An Additional Addgene Controlled...

...pAAV-EFS-SpCas9 EFS-driven, constitutive Expression of Myc-tagged SpCas9. 8 Ryohei Yasuda Labeling Tools These...

... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...an n-terminal DNA recognition domain and a mostly c-terminal nuclease domain. Feng Zhang's group utilized...Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and net influx into the nucleus...genes using dCas9-VP64 activator fragments (dCas9(C)-FKBP-2xNLS-VP64 and dCas9(N)-FRB-NES). This system...

...CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT... hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT 3...CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3' end of DsRed1 Forward ... Human elongation factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...

... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting...tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol...streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen’s lab from the University...paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive channel). ...Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM, Chodera JD. bioRxiv preprint...