Skip to main content

We narrowed to 2 results for: c-myc

Showing: 1 - 2 of 2 results
  1. Sequencing Primers

    Type
    Guide
    ...CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT...CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3' end of DsRed1 Forward ... Human elongation factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...
  2. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...thymine, cytosine, and guanine (abbreviated to A, T, C, and G, respectively). The bases are organized into... hydrogen bonds, where A always pairs with T, and C always pairs with G. The order of nucleotides makes...vitro DNA replication in addition to the normal A, T, C, or G nucleotides. The four standard bases (dNTPs)...emitted each time a base is added. Again, each base (A,C,T, or G) is labeled with a different color, making...
Showing: 1 - 2 of 2 results