We narrowed to 4 results for: c-myc
-
TypeGuide... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ...transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of...elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of ...primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...
-
Molecular Biology Reference
TypeGuide... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...thymine, cytosine, and guanine (abbreviated to A, T, C, and G respectively) that are organized into a double...1000X stock solutions and storing aliquots at -20°C. To use, dilute your antibiotic into your LB medium...complementary, strand. Specifically, A pairs with T and C pairs with G. During replication, DNA unwinds and ... -
Lentiviral Vector Guide
TypeGuide.... M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...PMID: 33768124 Marshall, H. M., Ronen, K., Berry, C., Llano, M., Sutherland, H., Saenz, D., Bickmore, ...PMID: 18092005 Merten, O., Hebben, M., & Bovolenta, C. (2016). Production of lentiviral vectors. Molecular...Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety features of lentiviral vectors....., Kochenderfer, J. N., Norberg, S. M., Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R.... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Gamma-Retroviral Vector Guide
TypeGuide...Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus integration marks cell Type-Specific...10.1371/journal.pone.0154070 PMID: 27097319 LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G....gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral vectors:...Rubat, L., Nikoniuk, A., Macmorland, W., Horlock, C., Matsumoto, S., Williams, S., Smith, K., Price, J... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...