...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...for example, plasmid with a puromycin resistance cassette, such as PX459). After you co-transfect the CRISPR...

...nature of GFP fluorescence to create an improved fluorescent aptamer system. Knowing that GFP’s  structure... Experiments Learn more about GFP Controlling Protein Activity with GFP Resources at Addgene.org Find...increase its fluorescence, essentially mimicking GFP.  Though the aptamer, called Spinach, required longer...RNA-based scaffolds to contain and stabilize Broccoli cassettes, thereby extending their use into mammalian cells...

...option rtTA On Kowarz 16623 pBI-GFP Expression of your gene of interest & GFP from a bidirectional tet-responsive... line generation; contains expression cassette for TetR-P2A-GFP; see article for additional constructs...inducible expression for Gateway cloning; selection cassette in format: PGK-rtTA-2A-puro; see article for tagged...inducible expression of a miR-shRNA; selection cassette in format: rtTA3+IRES+Neo; see article for additional...Either Lung 11662 pPRIME-TET-GFP-FF3 Lentiviral, miRNA expression (PRIME) system for application in knockdown...cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None Either Elledge 35625...Safe Harbor Locus. Tet-On 3G On Doyon 58245 pGLTR-X-GFP Single vector lentiviral Gateway RNAi system for ...

...kanamycin cassettes and were carefully designed to allow for easy removal of the resistance cassette via Cre...the transcription factors from a polycistronic cassette. However, it was unknown whether variations in...in gene expression from these polycistronic cassettes could lead to comparable experimental results. Using...compared different variants of the polycistronic cassettes and discovered reprogramming discrepancies, which... Klf4 isoform (KLF4s or KLF4L). Polycistronic cassettes that contained KLF4s had overall diminished KLF4...global gene expression patterns. Polycistronic cassettes that contained the KLF4L isoform had more robust...-positive assay) as well as stabilization (Nanog-GFP reporter activation and silencing of factor-linked...

...translation-blocking STOP cassette immediately following the promoter. The STOP cassette includes a mutant YFP...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...eliminating two color possibilities. The remaining cassette can invert as long as Cre remains expressed; once... and sequence overlap (coral mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully... is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2 as the fluorophores; mOrange2 is the ...

...considerably faster, with expression levels comparable to GFP during early embryogenesis (Figure 3). mScarlet-I3...through the middle of each embryo are shown, comparing GFP, wrmScarlet (mScarlet), and the new mScarlet3 and...This strain is then transformed with the sgRNA cassette on a plasmid expressing mCherry and resistance... focal adhesion marker paxillin (visualized with GFP). Reprinted with permission from Zhong et al, 2024...shorter than many popular fluorescence markers like GFP (510 nm), allowing co-imaging. And because bioluminescent...

...system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous proteins...vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences and...deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin (FBL... general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen Lab SapTrap CRISPR/Cas...cells that uses PCR to generate both an expression cassette for the Cas9-programming sgRNA and HR donors for...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent... expression vector allows for efficient marker cassette FLP-out. Plasmids can be found associated with...

...reported was PA-GFP. PA-GFP was derived from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating Threonine...mutation in PA-GFP generates a chromophore population that is more neutral, causing PA-GFP to display almost...Markus, and Wei‐Lih Lee. "Photoactivatable GFP tagging cassettes for protein‐tracking studies in the budding...example, by engineering PA-GFP tagged to a mitochondrial matrix protein (mito-PAGFP) the Youle Lab was able...the neutral to the anionic form, which allows PA-GFP to exhibit up to a 100-fold increase in fluorescence...when illuminated with blue light (1). Similar to PA-GFP, scientists later developed red fluorescent PA-FPs...in vivo imaging models perfer the PA-RFPs over PA-GFP. Another class of irreversible PA-FPs are the photoconvertible...

...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV... CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre...CAG Retroviral Gage 49056 AAV-GFP/Cre Cre-GFP fusion CMV AAV Gage 49111 pEMS1980 iCre with MCS for inserting...

...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler...expression of EGFP and the gene of interest, also can express shRNA (cloning H1-shRNA cassettes into the unique... plasmid with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned ...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...

...2) a transposon containing the gene-expression cassette that can translocate within the genome. The Sleeping..., hygromycin) and fluorescent protein reporters (GFP, BFP, RFP, no FP). The vectors each contain two SfiI...

... from the default GFP (green) to RFP, CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a ...and activate fluorescence of the downstream OFP, GFP, or RFP. Cells that express the construct but do ... same XFP transgene in an adult fly. As a stop cassette is located directly upstream of the fluorescent...generates cells that randomly express either nuclear GFP, membrane CFP, cytoplasmic YFP, or cytoplasmic RFP...incorporates the highly photostable fluorophores mOrange2, EGFP, and mKate2 (red) to solve the problematically low...

...containing an expression cassette with an ubiquitous promoter to express GFP in a group of young rats....label norepinephrine (NE) expressing neurons and GFP (green) to label neurons transduced by each serotype...

... pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)...pgRNA_bacteria ) contains a constitutive sgRNA expression cassette on a ColE1 vector with ampicillin resistance, ...contains a murine U6 promoter controlled sgRNA cassette, wherein the GN19 can be custom designed to target...also contains a CMV-puro-t2A-mCherry expression cassette, useful for selection or fluorescent gating of...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...targeting endogenous CD71 gene 46919 pMLS-SV40-EGFP Target EGFP gene that is stably integrated into HEK293...

...protein (EGFP) reconstitution. (a) Scheme of validation for DSB mediated EGFP expression cassette reconstitution...annealing) took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330...MCS) between EGFP fragments. The pX330 plasmid contains humanized Cas9 expression cassette and sgRNA expression...expression cassette. The target sgRNA can be cloned directionally into the BbsI site. (c) The pCAG-EGxxFP...halves of EGFP to recombine by homology directed repair, and resulting in the expression of EGFP. Using ...pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the ubiquitous CAG promoter. The...indicates where your target is inserted, disrupting the EGFP fluorescent signal, for details on this plasmid,...

... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145... guide RNA expression cassettes and a Cas9 nuclease/nickase expression cassette using the Golden Gate ...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...the expression of multipe gRNAs. Csy4 cleavable cassettes; requires expression of Csy4 (eg Plasmid 53369...gRNA module vectors, multiple gRNA expression cassettes can be assembled using Golden Gate cloning or ...polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into a Cas9 expressing vector. Yang...

... their favorite selection cassette. They could also switch from FLAG to GFP or a different epitope. Addgene...

...that incorporate a self-excising drug selection cassette (SEC). More information regarding this kit can...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores... promoter and expression of the target FLP-out cassette from either a ubiquitous or a tissue-specific ...

...individual expression cassettes, having the genes expressed from the same cassette is sometimes advantageous...and you can then insert the whole multicistronic cassette into a backbone as a single unit. Although it ...Multicistronic Element Expression Type MSCV-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...