We narrowed to 25 results for: ha ubiquitin

...sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP... RF1 function removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 ...This strategy, called genetic code expansion (GCE), has transformed synthetic biology by providing access....1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA synthetase...

...promoter Forward HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT ... Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F TGGCTCTCCTCAAGCGTATT...sequencing (NGS) for plasmid verification, Addgene has used a number of primers for Sanger sequence verification...

...protein–protein interactions. The Roux lab has deposited HA tagged BioID2 for N-terminal fusions and Myc...AID tag could be targeted for degredation via ubiquitination. The key feature of auxin-induced degredation... activation of these receptors. Bryan Roth's lab has a newly available PRESTO-TANGO kit which allows researchers...the NCI RAS Initiative, led by Dominic Esposito, has recently released a collection of 360 Ras pathway...24395366 Oxford Drosophila CRISPR library Addgene has had the privilege of distributing several human and...this 3-day goal is is now attainable. The Jacks lab has recently introduced a new assembly cloning platform...Addgene to help expand the collection! The Jacks lab has made several GMAP-compatible plasmids available to...

...for bimolecular fluorescence complementation BiFC has been used to directly visualize PPIs that regulate... PIPs in which the protein-interaction interface has been compromised (Kodama and Hu, 2012). Such controls...regulate numerous cellular functions, including ubiquitinoylation, kinase signaling, integrin signaling, and...

...beta - HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-... MHC-G HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-...MSTP084 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-...associated protein C20orf188, TRRP4AP, TRUSS UBR1 ubiquitin protein ligase E3 component n-recognin 1 JBS, ...