...physiologically similar to humans than many other model organisms, they are often used to study human diseases. Diseases...counterpart in humans (Liu et al., 2017) . Thus yeast can be used to study the molecular basis of human diseases...They share about 70% of their genes with humans and 85% of human genes associated with a disease have a ...completely sequenced and over 60% of human genes have an ortholog in C. elegans making it ideal to study ...PMCID: PMC5525645. Mello, Craig C., et al. "Efficient gene transfer in C. elegans: extrachromosomal maintenance... 190-195. Liu, Wei, et al. "From Saccharomyces cerevisiae to human: The important gene co‑expression ...the globe. These organisms share many genes with humans, are easily maintained in the lab, and have short...

... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C   Detecting... both human and fly versions. Arnold, et al. Science. 2013. PubMed PMID: 23328393 Wu lab human lentiviral...   Human kinase domain constructs for automated bacterial expression The misregulation of human kinases...Lab recently compiled the Human Kinase Domain Constructs Kit, a library of human kinase domain constructs...tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol...gRNAs targeting a total of 20,121 genes within the human genome (the identity of the genes and target sequences...

...including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian... CIneo-RL Renilla CMV Mammalian expression of humanized renilla luciferase Witold Filipowicz 100984 pGL4.18...pathway in vivo . DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced Nano-lanterns...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...

...with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting...Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage...., R is a purine (A,G), and Y is a pyrimidine (C,U). G-C content should be 36-52%. Sense 3’ end should ...annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning vector from step C.3 (If you were unable ...Store at 4°C. m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO ...at 37°C, 5% CO 2 overnight. Day 2: b. The target cells should be approximately 80-90% confluent. c. Dilute...solution is stable at 4°C for up to one year. The powder form of polybrene is stable at 4°C for several years...

... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and...thermophilus which have been used for gene editing in human cells without cross-talk in cognate sgRNA binding...understanding the spatio-temporal regulation of human genes. The plasmids are all available at Addgene...These three enzymes were chosen because they cut human and mouse coding regions infrequently; any MluI,...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...

...different types of tags, including epitope tags (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry... expression systems that can be added to the N or C terminus of your protein of interest. Many of these...Gene Expression Protocols (Vol. 205, pp. 99–118). Humana Press. https://doi.org/10.1385/1-59259-301-1:99...

... for gene disruption in Mycobacterium abscessus, an increasingly common human pathogen notorious for its... use in revealing antigenic differences between human, canine and simian isolates. J Gen Virol., 68 (Pt...luciferase is embedded in the I10 domain of the human titin protein and only exposed when the module unfolds...Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene disruption in M. abscessus...tagging proteins, as it can be fused to the N- or C-terminus (or even in the middle of proteins) and performs.... E., Young, D. F., Goswami, K. K., & Russell, W. C. (1987). Isolation and characterization of monoclonal...39406745. Optimizing mScarlet tags for live imaging in C. elegans By Alyssa Neuhaus Red fluorescent proteins...

...sites (thrombin and TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, Myc). These constructs include...Spike Proteins. In: Methods in Molecular Biology. Humana Press, pp 331–338 https://doi.org/10.1007/978-1...

...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...the human Estrogen Binding Domain (EBD) TDH3 Yeast van Leeuwen 64770 pSS146 Cre fused to the human Estrogen...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion... a circular piece of DNA (and is not maintained). C) If the sites are on separate DNA molecules (in trans... Cre: Cre recombinase is split in half into N and C terminal Cre fragments (NCre and CCre, respectively...Bacterial Ekker 47551 pDD104 (Peft-3::Cre) Cre eft-3 C. elegans Goldstein 48201 CAG-GFP-IRES-CRE Cre and ...system CAG Mammalian Pelczar 51268 pCAG-Co-InCreC C-terminal component of the Co-InCre system CAG Mammalian...

...CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla...Weinberg Lab) Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ...TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG...forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT... CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO...LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev CCTTATGCAGTTGCTCTCC...

...supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human, rat, cow, dog, pig, Thale cress, rice... cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish, mouse, rat, and human. CCTop - CRISPR/Cas9 target...include Arabidopsis, C. elegans , sea squirt, cavefish, Chinese hamster, fruit fly, human, rice fish, mouse...supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human, rat, rabbit, pig, possum, chicken, dog...: Drosophila, Arabidopsis, zebrafish, C. elegans , mouse, human, rat, yeast, frog, Brachypodium distachyon...Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (pSIR-hCD2...location, and genome annotation. Available genomes are human (hg19 & hg38), mouse (mm10), and yeast (strain w303...

...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...viral vector genome titers by droplet digital PCR. Human Gene Therapy Methods, 25(2), Article 2. https://...Infectious Titer by a Novel Droplet Digital PCR Method. Human Gene Therapy Methods, 29(2), 96–103. https://doi.org...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...preparations are then aliquoted, frozen, and stored at -80 °C. Concentrated lentiviral preparations (“-LVC” catalog..., and is routinely tested for mycoplasma contamination using mycoplasma detection kits. Cell line is maintained... tested for mycoplasma contamination. To date, Addgene has never had a case of mycoplasma contamination...

...difficult to grow. Growth Temp Choose from 30 °C, 37 °C, or room temperature. Growth Strain Please...Species of Gene or Insert Choose from: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), G. gallus...plasmid will produce anything dangerous or toxic to humans in bacteria, select “yes” in the drop-down and ...frog), D. rerio (zebrafish), D. melanogaster (fly), C. elegans (nematode), S. cerevisiae (budding yeast)... gentamicin, hygromycin, kanamycin, nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline...maintain a glycerol stock. Choose from: ampicillin, apramycin, blasticidin, bleocin (zeocin), chloramphenicol...

...analyze the base editing capability of the seven human APOBEC3 proteins, finding that APOBEC3A and APOBEC3bctd...ACG start codon mutation, and integrated it into human and mouse cells that expressed either Cas9 or an...transient reporter for editing enrichment (TREE) in human cells. Nucleic Acids Research 47:e120–e120 . https...expressed to identify successfully transfected cells. C-to-T editing by the APOBEC-Cas9 editosome would restore...codon that is converted to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes the histidine... ATG codon from an ACG codon using a base-editor (C>T conversion) they could induce the translation of...Liu DR (2017) Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551:464...

...02708-5 Hrit J, Goodrich L, Li C, et al. (2018) OGT binds a conserved C-terminal domain of TET1 to regulate...unusual patterns of DNA methylation detected in a human disease: cancer (Feinberg & Vogelstein 1983). The...1983) Hypomethylation distinguishes genes of some human cancers from their normal counterparts. Nature 301...89–92. https://doi.org/10.1038/301089a0. Galonska C, Charlton J, Mattei AL et al (2018). Genome-wide tracking...https://doi.org/10.7554/eLife.34870.  Kaas GA, Zhong C, Eason DE, Ross DL, Vachhani RV, Ming G-L, King JR...lentiviral backbones expressing blasticidin or puromycin resistance genes.  It’s that simple! Good luck...

...target sequence downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer than...arrays (e.g. for spacers A, B, and C, you could obtain arrays A, B, C, AB, AC, BC, and ABC). Nielsen Lab...lab. pX333, a modification of pX330, contains humanized wtCas9 and two U6 promoters. To use this plasmid...destination vectors. Destination vector options include humanized wt Cas9, dCas9 (transcriptional repressor), and...plasmids, multiple Cas9 variants are available: wt humanized Cas9, D10A nickase mutant (Cas9n), dCas9 (transcriptional...used to create lentiviral vectors expressing wt humanized Cas9 and up to three gRNAs. Entry vectors containing...Tetsushi, et al. “Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system...

...the potential CRISPR technology can have on the human microbiome. You can consider the microbiome as a...and metabolic processes, occupying the gut. Many human diseases have connections to either specific organisms.... Engineering the bee gut microbiome Beyond the human gut, the Barrick lab has deposited plasmids that... of cytidine and adenine base editors that enable C-to-T and A-to-G base substitutions respectively. Substitutions...:723–728 . https://doi.org/10.1021/sb500351f Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG (2018... https://doi.org/10.1016/j.cell.2013.02.022 Ronda C, Pedersen LE, Sommer MOA, Nielsen AT (2016) CRMAGE...Vridhambal GS, Rivera AJ, Montgomery SA, Fortier L-C, Barrangou R, Theriot CM, Ousterout DG (2020) In Vivo...

...in vivo screening of human promoters, the Zhang Lab found a short fragment of human IBA1 promoter (hIBA1a...screens in human cells. Addgene offers vectors for CROPseq-multi using selection by Puromycin, Zeocin®,...various contexts in vitro and in vivo, including in human retinal organoids and live mice. Importantly, REVeRT...specificity of GFP expression for the indicated ssAAV5s. C) Quantifications showing high microglia transduction... microglia-targeting AAV plasmids here! Serrano, C., et al. (2023). Simple and Highly Specific Targeting...

...Mammalian systems (Human, mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) ...editing. These edits can include mutations seen in human patients, protein tags, or loxP/FRT sites, among...germline editing, with the International Summit of Human Gene Editing convened in 2015 to discuss the ethics...2013. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell . ... Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep . 13(3):621-33. PMID: 26456817 Fu...Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci U S A . 112(10):3002-7...DiCarlo JE, Norville JE, Church GM. 2013. RNA-guided human genome engineering via Cas9. Science . 339(6121)...

...jcm.23.5.959-961.1986 Lobstein, J., Emrich, C. A., Jeans, C., Faulkner, M., Riggs, P., & Berkmen, M. (2012...not fully suppress Zeocin-induced DNA cleavage in human cells. Mutagenesis, 20(2), 111–114. https://doi....References Hwang, J. M., Piccinini, T. E., Lammel, C. J., Hadley, W. K., & Brooks, G. F. (1986). Effect...Slow transformation   Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis.... Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability (streptomycin), doesn’t work for... for transformations. Con: Expensive.   Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits...Like carb, spectinomycin is the more stable and expensive antibiotic compared to streptomycin. Spectinomycin...