Skip to main content
Addgene

We narrowed to 26 results for: lacz gene

Showing: 21 - 26 of 26 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330 Zhang...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...
  2. Molecular Biology Reference

    Type
    Guide
    ...bacterial populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin...transcription. Gene Knock-down Plasmids - Used for reducing the expression of an endogenous gene. This is frequently...chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists can easily...easily study and manipulate genes and other genetic elements using specifically engineered plasmids, commonly...when a gene is inserted within the MCS, its expression will be driven by the promoter. As a general rule...the gene, promoter, or other DNA fragment cloned into the MCS. The insert is typically the genetic element...experiment, see Addgene's empty backbone page for more information. Expression Plasmids - Used for gene expression...
  3. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... cassette to the gene of interest. The gene to be expressed is amplified using a gene-specific forward...sgRNA-targeted gene, resulting in increased activation of endogenous transcription of the target gene. The brilliant...of downstream genes. Nihongaki et al describe the targeted activation of endogenous genes and detail the...efficiency and gene expression. The pUCXKT vector ensures that all screened plasmids contain a gene variant*...resistance gene (missing the first two codons). Two stop codons are inserted between the truncated gene and ... inducible, gene knockdown with shRNA or shRNA-miR30, (2) tamoxifen-inducible CreERT2 gene deletion, (...on target gene activation. The novel dCas9-VPR activator is capable of enhancing target gene expression...
  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... distribution via Addgene. For a full list of Addgene's viral vectors See Addgene's Current AAV inventory... from the Penn Vector Core. Chemogenetics (including DREADDs) Optogenetics Recombinases Calcium Sensors... are now available for distribution at Addgene: Penn ID Addgene ID Name Function PI AV-1-49531P 100040...tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda...mCherry.WPRE.SV40 Optogenetics Karl Deisseroth AV-1-26966P 26966-AAV1 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics Karl...eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics Karl Deisseroth...EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics Karl...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD Mark Mayford 35000...protein (FP) tags. Information on genes and associated neurodegenerative diseases was curated from several...but not exhaustive. If you do not see a particular gene of interest, please search our full plasmid collection... Huntington's Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized... T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI 1177 p416 25Q GPD HTT GFP... Neurodegeneration Neurodegeneration Plasmids Neurodegeneration Plasmid Collection Addgene has a ...Spinal muscular atrophy Eugene Yeo 156073 TARDBP TARDBP V5-MCP EF1a ALS Eugene Yeo 156883 pD649-HAsp-CSF1R-Fc...
  6. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...yes, cut S. pyogenes NatMX Zaratiegui All_in_one_CRISPR/Cas9_LacZ 74293 Mammalian S. pyogenes Neo, mCherry...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...
Showing: 21 - 26 of 26 results