Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 40 results for: luciferase reporter

Showing: 21 - 40 of 40 results

  1. Plasmids 101: Multicistronic Vectors

    Type
    Blog Post
    ...along with a reporter, such as a fluorescence gene or a resistance gene. These reporters allow you to ... using IRES elements. Further, scientists have reported lower expression of the downstream cistron due...eukaryotic cells, and, although some scientists report close to 100% cleavage with some of these peptides...that already has the multicistronic element and reporter cloned in. In these plasmids you would simply ... 2A element (depending on the placement of the reporter gene). Addgene's collection offers a variety of...Retroviral pEF1a-IRES-Neo IRES Mammalian MSCV-IRES-Luciferase IRES Retroviral pWPI IRES Lentiviral AmCyan-P2A-mCherry...multicistronic element(s), or you could replace one of the reporter genes above with your gene or genes of interest...

  2. Plasmids 101: What is a plasmid?

    Type
    Blog Post
    ...expression plasmids, gene knock-down plasmids, reporter plasmids, viral plasmids, and genome engineering...Green Fluorescent Protein (GFP) Plasmids 101: Luciferase Monitor the level of a chemical in a particular...

  3. Working with Nuclear Receptors

    Type
    Blog Post
    ...the reporter gene has over the years evolved from chloramphenicol acetyltransferase to luciferase, the...the development of a vast number expression and reporter plasmids and the free exchange of these vectors...

  4. When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells

    Type
    Blog Post
    ...Fluorescent Protein (GFP/EGFP) for a transcriptional reporter or as a general cytoplasmic label of cells, there's...Incorporation into a FRET biosensor A FRET biosensor is a reporter that undergoes a conformational change to bring...help you make better fluorescent fusion protein reporters for your studies and greatly lower your chances...Protein Resources Find Other Plasmids that Glow (Luciferase Plasmids) Find Optogenetics Resources ...FP dimerization. Equally problematic, several reportedly monomeric FPs are not actually monomeric, at ...

  6. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ... (abundant in eukaryotes) A Near-Infrared BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions...green-yellow or orange-red fluorogen A split fluorescent reporter with rapid and reversible complementation. Tebo....org Fluorescent Biosensors Collection Split Luciferase systems, including NanoLuc®, DULIP, LuTHy Other...

  7. New CRISPR Tools: Cas7-11 and PASTE

    Type
    Blog Post
    ...RNA editing tools.   Fig. 1 Schematic of luciferase RNA knockdown assays using Cas7-11   Use .... Specifically, efficacy rates of Cas7-11 were reported as up to 85%, broadly similar to shRNA and Cas13...However, in those same comparisons, the AbuGoot lab reported no detectable effect on cell viability – meaning...

  8. Plasmids 101: Control Plasmids

    Type
    Blog Post
    ...that constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either co-transfected... well of your cells. Regardless, the amount of reporter protein activity correlates to both the amount...

  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and prey...-ome using a quick, affordable, and ubiquitous reporter assay. In their recent publication, Kroeze et ...immunoprecipitated from the cells using the Protein A tag. The luciferase activities can then be measured and normalized... assess interactions. Higher relative firefly luciferase activity in the Co-IP compared of a control Co-IP...endogenous proteins. As described in their recent Cell Reports paper, the Kanemaki lab overcame this hurdle using...TRIBE is the low input required - McMahon et al., report using as few as 150 fly neurons as their starting...delivery of robust CRISPR activators We previously reported on a novel Cas9-based activator developed by the...

  11. Hot Plasmids: Winter 2025

    Type
    Blog Post
    ... a YFP-tagged G protein and a NanoLuc® (Nluc) Luciferase-fused detector that specifically binds to active...6E10-A5] in Immunohistochemistry (Human). Addgene Report, doi: https://doi.org/10.57733/addgene.6ncijt.  ...

  12. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

    Type
    Blog Post
    ...concept, they tested a lux-mediated bioluminescence reporter in vivo in the absence of selective pressure and...Cara E., and James B. Kaper. "Use of stabilized luciferase-expressing plasmids to examine in vivo-induced...

  14. COVID-19 Resources

    Type
    Collection
    ...pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been used for ...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...(Link opens in a new window) CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...

  15. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Plasmids Recombinase-Dependent Empty Backbones Reporter Plasmids Pooled Libraries/Kits You may also like...recombinases , as well as useful empty backbones or reporters . Experimental Considerations Recombinase Recognition... plasmids. Return to top Recombinase-Dependent Reporter Plasmids Incorporating a fluorescent protein into...visualize which cells have undergone recombination. Reporter plasmids can also be useful for lineage tracing...Use this AAV CRISPR knockout library expressing luciferase and Cre to interrogate tumorigenesis in vivo ...

  16. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...control expression of a chemogenetic reporter ensures that the reporter remains silent until a cell or tissue-specific...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

  17. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins Ratiometric...

  18. Molecular Biology Reference

    Type
    Guide
    ...elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out ...information on CRISPR check out Addgene’s CRISPR guide . Reporter Plasmids - Used for studying the function of genetic...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...

  19. Tetracycline Inducible Expression

    Type
    Collection
    ...efficacy by fluorescence, use Plasmid #35626 as a reporter for cDNA target. rtTA3 Ptet, miniCMV Howard Gu...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,...

  20. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...
Showing: 21 - 40 of 40 results