Skip to main content

We narrowed to 94 results for: mcherry

Showing: 21 - 40 of 94 results
  1. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...traditional homologous recombination methods). By using mCherry for selection of sgRNA plasmid transformants, they...with the sgRNA cassette on a plasmid expressing mCherry and resistance selection marker HygR. The CRISPR...disruption of the target gene. Lastly, curing the mCherry-sgRNA plasmid leaves an edited strain carrying ...
  2. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) under the control of Cre recombinase. After in-utero...and synaptic proteins (e.g. postsynaptic PSD95-mcherry) are used in high concentrations in combination...morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the control of Flp recombinase together...
  3. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...designed by putting together the coding sequence of a mCherry fluorescent protein followed by a stop codon and... flow cytometry is used to sort populations by mCherry and GFP expression to check for ABE’s. b) Quantification...
  4. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ... 3’ UTR of the reporter mRNA is labeled by PCP-mCherry (Figure 2). The 3’ UTR also contains a CAAX sequence...membrane; this sequence prevents diffusion of the mCherry labeled mRNA and keeps it in a single field of ...
  5. Hot Plasmids - January 2023

    Type
    Blog Post
    ...promoter drives expression of an mCherry reporter.  After using mCherry for FACS sorting of the weaponized...
  6. Fluorescence Titering Assay

    Type
    Protocol
    ...of pHAGE-TO-dCas9-3XmCherry . 72 h post transduction, cells were assayed for mCherry expression using ...
  7. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ... as the first letter in the protein name, e.g. mCherry). Oxygen: The maturation of the chromophore on ...sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours...
  8. Hot Plasmids - August 2020

    Type
    Blog Post
    ...and modulate transcription of the mCitrine gene. mCherry is constitutively expressed. Cells are then cultured...mDlx-GCaMP6f, hDlx-GiDREADD-dTomato and mDlx-ChR2-mCherry. Find these AAVs at Addgene ...
  9. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...mutagenesis screening for enhanced RFP variants. PA-mCherry (E26V / A58T / K69N / L84F / N99K / S148L / I165V...UV-Violet or blue Green/ Red 4,500 High 553/ 573 PA-mCherries Monomer UV-Violet Dark/ Red >3,000 Medium 570/.... 2.Subach, Fedor V., et al. "Photoactivatable mCherry for high-resolution two-color fluorescence microscopy...
  10. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin...mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or...one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize simultaneously...mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment...
  11. Sequencing Primers

    Type
    Guide
    ...binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry Forward mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward...
  12. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...reporter activation and silencing of factor-linked mCherry). They additionally discovered that monocistronic...last month, Robert Campbell’s lab added two new mCherry variants to the repository. These variants can ...ONE paper for more on the directed evolution of mCherry and the spectral properties of various RFPs. For...Listen to Our Podcast Segment on PhoCl LSSmCherry1 & RDSmCherry1: Engineering and directed evolution of...influence of structure on an FP’s properties. pBAD-LSSmCherry1 is a long Stokes shift variant, which could be...two-photon microscopy using Ti-Sapphire lasers. pBAD-RDSmCherry1 is a red-shifted variant which, with further ...
  13. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...p2A-ferritin-p2A-mCherry Mammalian Expression 74308 pcDNA3.0-Magneto2.0-p2A-mCherry Mammalian Expression...and named it Magneto 2.0. Using Magneto2.0-p2A-mCherry constructs, the lab verified that Magneto2.0 was...Expression 74334 pCR8-Magneto2.0-p2A-mCherry Gateway 74333 pCR8-Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0...AAV 74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain...addition, some versions of the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to...
  14. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ... Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used for...
Showing: 21 - 40 of 94 results