We narrowed to 61 results for: sap

1. Deck the Lab 2022!

   Type

   Blog Post

   ...set a challenge to my lab mates. They did not disappoint. #deckthelab pic.twitter.com/X4eKUGnQMe— Alex...

2. Editor's Choice, July 2016

   Type

   Blog Post

   ...Guest Blogger Form and we'll be in contact with you ASAP. Happy Reading! Tyler ...

3. Plasmids 101: How to Name Your Plasmid in 3 Easy Steps

   Type

   Blog Post

   ...species it is. Example: ‘h’ is for Human (homo sapiens), ‘m’ is for mouse (mus musculus), ‘r’ is for rat...

4. Reflections and Looking Ahead

   Type

   Blog Post

   ...W., Polinski, N. K., Meijers, R., Levey, A. I., Saper, C. B., Errington, T. M., Turn, R. E., Bandrowski...

5. Scientist Networking: What is an Informational Interview?

   Type

   Blog Post

   ...opportunities for advancement, challenges and disappointments. These more personal questions can elicit the...

6. Searchable and Sortable gRNAs for Your Next CRISPR Experiment

   Type

   Blog Post

   ... for activation in a human system, search for ‘sapiens activate’ to filter the table and find exactly ...

7. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

   Type

   Blog Post

   ...violet range. For example, mWasabi can be used with Sapphire (excitation maximum 399 nm) because it does not...

8. Virtual Science Conference Coming Up? Three Addgenies Share Their Experience

   Type

   Blog Post

   ...Having an on-site conference canceled may be disappointing, but there are many creative ways to adapt and...

9. Revamp Your Lab Meetings With Creative Virtual Collaboration

   Type

   Blog Post

   ...approach of a brain break, where everyone stands up, disappears from the video, and prepares a coffee, or simply...

10. Transferable Skills Guide: Public Speaking

    Type

    Blog Post

    ...interest incorrectly on slides 8-16. Your notes disappear. The wrong version of your slide deck gets uploaded...

11. Hot Plasmids and Viral Preps - March 2021

    Type

    Blog Post

    ...highly useful vectors compatible with Gibson and Saptrap cloning systems to generate AID* tagged CRISPR ...

12. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type

    Blog Post

    ... Species of Gene or Insert Choose from: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat...

13. Transferable Skills: Negotiation

    Type

    Blog Post

    ...straightforward, it can mean that everyone leaves disappointed (we’ve all won an argument but felt bad afterwards...

14. Hot Plasmids: Summer 2025

    Type

    Blog Post

    ...BY license. Libraries are available with T-Sapphire, EGFP, or mScarlet reporters, so you can choose...

15. Which Fluorescent Protein Should I Use?

    Type

    Blog Post

    ...emission is green or red light. For example, T-Sapphire, LSSmOrange, and LSSmKate. Fluorescent Sensors...

16. CRISPR Between the Genes: How to Experiment with Enhancers and Epigenomics

    Type

    Blog Post

    ...mechanism for CRISPR. Therefore if a gRNA drops or disappears over time, we infer that the enhancer it targets...

17. Interview: Hodaka Fujii on enChIP, New CRISPR Tools, and More

    Type

    Blog Post

    ...which only one was done in Japan, which is very disappointing. I hope I can help change the situation in the...

18. Validated gRNA Sequences

    Type

    Collection

    ...Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple,...AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate S. pyogenes 25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG...ASCL1 H. sapiens TGGGGCTGGGTGTCCCATTGAAA 64129 activate S. pyogenes 25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC...ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT...AXIN2 H. sapiens TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG...

19. Trimmer Lab NeuroMab Collection

    Type

    Collection

    ... 190303 Anti-SAPAP1 [N238/29] SAPAP1 Rat Mouse IgG2a 190304 Anti-SAPAP1 [N238/30] SAPAP1 Rat Mouse IgG2a...anti-SAPAP2 nanobody SS80 SAPAP2 Mouse Llama 145818 SS1 pComb3xss anti-SAPAP2 nanobody SS1 SAPAP2 Rat ... anti-SAPAP2 nanobody SC27 SAPAP2 Rat Llama 145820 SS2 pComb3xss anti-SAPAP2 nanobody SS2 SAPAP2 Rat Llama...anti-SAPAP2 nanobody SS3 SAPAP2 Rat Llama 145822 SS32 pComb3xss anti-SAPAP2 nanobody SS32 SAPAP2 Rat Llama...anti-SAPAP2 nanobody SS41 SAPAP2 Rat Llama 145824 SS44 pComb3xss anti-SAPAP2 nanobody SS44 SAPAP2 Rat ...-2 Mouse Mouse IgG2a 114529 Anti-Pan-SAPAP [N127/31.1R] Pan-SAPAP Rat Mouse IgG2a 114530 Anti-Neurexin...Pan-Nav Channel Mouse IgG2a 128624 Anti-SAP97 [K64/15R] SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin...

20. Replacing Paper: Tips for Choosing an Electronic lab Notebook

    Type

    Blog Post

    ...Project: Cancer Biology have shown similarly disappointing rates of reproducibility. These alarming results...