Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 79 results for: tet off

Showing: 21 - 40 of 79 results

  1. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling...

  2. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...including cDNA expression, shRNA-mediated knockdown, Tet and Cre-regulated expression, CRISPR genome editing...; however, the 3rd-generation packaging systems offer the maximal biosafety available for the technology...

  3. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Return to top Reversibly Photoswitchable (e.g. Off to On to Off) Protein Excitation (nm) Emission (nm) Activation...Structure Plasmids rsTagRFP 567 585 440 (Off to On) 567 (On to Off) 4.0 6.6 43 min Prone to dimerization ...Bacterial Expression iLOV 447 497 467 (On to Off) Spontaneous (Off to On) Monomer pEiLOV-N1 - Mammalian Expression...Mammalian Expression rsEGFP2 478 503 408 (Off to On) 503 (On to Off) 18 5.8 20 min pcDuex2-rsEGFP2-E - Mammalian...Bacterial Expression rsEGFP1 493 510 405 (Off to On) 491 (On to Off) 17 6.5 3 h rsGFP1-pBAD - Bacterial Expression...Expression Dronpa3 490 515 405 (Off to On) 490 (On to Off) 19 Monomer Dronpa3-N1 - Mammalian Expression...Mammalian Expression Dronpa 503 518 400 (Off to On) 503 (On to Off) 81 40 min Monomer pcDuex2-Dronpa - Mammalian...

  4. CRISPR Guide

    Type
    Collection
    ...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ...

  5. Neurodegeneration Research Collection

    Type
    Collection
    ... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...progression of Huntington’s disease. The foundation offers curated information on tools and reagents (Link...

  6. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter... 26627737 Moffat PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat PSMD1 H. ... 26627737 Moffat PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat PSMB2 H. ... 26627737 Moffat EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat EIF3D H. ...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha 1...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...

  7. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Cre-lox can be used to turn shRNA constructs on or off. In floxed-shRNA constructs, Cre can excise the shRNA...utilize recombination elements such as Cre to turn off the expression of one gene while simultaneously turning...with lineage-specific drivers can also help reduce off-target events and the systemic effects of Cre toxicity...only activated in the presence of tamoxifen. A tetracycline-regulated or other drug-inducible approach may...

  8. What's New in CRISPR - March 2020

    Type
    Blog Post
    ...Cas9-independent off-target DNA editing, ~5–50-fold lower levels of Cas9-dependent off-target DNA editing...repressor plasmids Cytosine base editors with minimized off-target DNA editing The original cytosine base editor...editor, BE3, induces a low frequency of genome-wide off-target DNA editing. Using several rapid and cost-... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...

  9. CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems

    Type
    Blog Post
    ...experiments 1. Reduce off-target effects Prolonged Cas activity can increase the chance of off-target editing...be used to limit this off-target editing, but when is the best time to shut off Cas activity? Using inhibitor... vectors. Having a way to shut off CRISPR-Cas systems prevents the off-target effects and cytotoxicity... to flip the switch and turn off CRISPR activity. The ability to turn off CRISPR activity is an important...there’s one thing that was missing: a way to shut off Cas’s activity. The concern is that the longer Cas...active in a cell, the greater chances there are for off-target edits to occur. Although methods to switch... drugs have been developed, the field lacked an “off-switch” for Cas proteins. Discovery of anti-CRISPR...

  10. Luciferase Plasmid Collection

    Type
    Collection
    ...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...popular plasmids expressing luciferase. We also offer ready-to-use AAV preparations of select luciferase...expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE Dox-inducible expression of firefly...

  11. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type
    Blog Post
    ...designed to improve on-target activity while reducing off-target effects in human genomes (Doench et al., 2016...based on their optimized sgRNA rules and potential off-target effects. The Dolcetto library contains two...previously established sgRNA rules and  potential on- and off-target effects. The 6 best sgRNAs were selected per...Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9." Nature biotechnology...while nuclease-deactivated Cas9 (dCas9) can be tethered to a repressor (CRISPRi) or an activation domain...RNA-guided DNA binding protein (dCas9). dCas9 is then tethered to a repressive domain, such as KRAB, to prevent...

  12. Better Dyeing Through Chemistry & Small Molecule Fluorophores

    Type
    Blog Post
    ... Other strategies that have been developed based off of this concept include: Self-labeling tags (e.g...cons All of these labeling strategies have trade-offs between the size of the genetically encoded tag,...discovered in 1856 by William Perkin. His discovery set off a flurry of activity and the majority of the classic...FlAsH, ReAsH) and a short genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins... lipoic acid ligase, biotin ligase, phosphopantetheinyltransferase) – These enzymes catalyze the covalent...1c). Click chemistry (e.g., transcyclooctene–tetrazine)– Nonnatural amino acids can be incorporated into...

  13. Viral Vectors 101: Optogenetic Tools

    Type
    Blog Post
    ... of light, with a different wavelength, turns it off, allowing the cell to be excited over a sustained...tools in their experiments. Some tools turn on and off rapidly with light to control precise timing of the...and activation kinetics Some channels turn on and off very rapidly in response to a single light pulse ...of how each tool performs and the consequences of off-target activity. Whether you are studying neuronal...photoswitchable tethered ligands (PTL), and photoswitchable, orthogonal, remotely-tethered ligands (PORTLs... secondary signaling pathways. Photoswitchable tethered ligands hold the ligand in close proximity to ...

  14. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ... typically achieve 90-99% knockdown with minimal off-target effects. The system also enabled them to turn...system. First of all, the Cas9s can be turned on and off, to reversibly activate or repress genes of interest...RNAs have different abilities to turn genes on and off,” he said. “Some are strong and some more moderate...where the degree to which genes are turned on and off varies depending on which guide RNA we use. What ...sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stem-loop 2; 3. The MS2-P65-HSF1 plasmid which...

  15. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ...TRICK (Translating RNA Imaging by Coat protein Knock-off) instead takes advantage of the ribosome’s movement...yellow. The act of translation pushes NLS-PCP-GFP off of the mRNA, leaving only a red FP bound to the reporter...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and is driven...of the PP7 and MS2 coat protein binding sites to tether many copies of the FP-coat protein fusions to their...these papers did. Since the SunTag-based system tethers mRNAs to the plasma membrane, it’s not appropriate...

  16. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ... In this system, light is used to turn “on” and “off” MEK1 activity by attaching two dimerizing photoswitchable... the Dronpa dimers interact and lock MEK1 in an “off” setting by blocking the active site. Dronpa also... thus indicates MEK1’s current state (Green when off, dark when on). Figure 1: Photoswitchable MEK1 (...psRaf1) followed by 3 seconds of 400 nm light (turn off psRaf1). After this, the phosphorylation status of...prone to aggregation in cells compared to the tetrameric Dronpa it was derived from. What are photoswitchable...

  17. Bacterial Expression Systems

    Type
    Collection
    ...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065...

  18. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic...

  19. What's New in CRISPR - December 2019

    Type
    Blog Post
    ...cytosine base editors, which decrease the rate of off-target genome edits compared to rat APOBEC1. Now,...CRISPR/Cas9 in cells has advantages like reduced off-target activity and decreased immune response to ...ribonucleoproteins for transient expression. They replaced the tetraloop of the sgRNA scaffold with a com aptamer which...

  20. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ... by DNMT3A or MQ1, and cytosine demethylation by Tet1. These modifications persist over time and are potentially...
Showing: 21 - 40 of 79 results