Skip to main content
Addgene
Showing: 21 - 40 of 81 results
  1. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...packaging systems, this system incorporates the Tet-off transcriptional activation system to drive high...associated with producing and using lentivirus and offer some tips and tricks for overcoming these hurdles...Guide. While the third generation packaging systems offer an extra level of safety, they also require a fourth...
  2. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...peptide-peptide ligation using SpyLigase Building off their SpyTag/SpyCatcher system for protein-peptide...mutagenesis (K176R) to improve the otherwise slow off-kinetics (15.8 ± 0.4ms from 21.4 ± 1.1 ms); this ...duration. Both of these strategies carry the risk of off-target effects. Harald Janovjak and his team at the...RUSH) use Cre-mediated recombination to turn on or off the expression of shRNA. This system requires less...expression. The capability to turn RUSH and CRUSH alleles off or on enables this method to rapidly address questions...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...
  3. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling...
  4. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...including cDNA expression, shRNA-mediated knockdown, Tet and Cre-regulated expression, CRISPR genome editing...; however, the 3rd-generation packaging systems offer the maximal biosafety available for the technology...
  5. Plan Your Experiment

    Type
    Guide
    ...sites are called off-targets and should be examined during gRNA design. In general, off-target sites are...reagents may be more appropriate. In cases where off-target editing is a major concern, Cas9-gRNA ribonucleoprotein... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic...components Short window of CRISPR activity may decrease off-target effects Additional Resources: CRISPR protocols...nearby. Select gRNAs based on predicted on-target and off-target activity A PAM sequence is absolutely necessary...using a high-fidelity Cas enzyme. In addition to off-target activity , it is also important to consider...
  6. CRISPR Guide

    Type
    Collection
    ...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ...
  7. Neurodegeneration Research Collection

    Type
    Collection
    ... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...progression of Huntington’s disease. The foundation offers curated information on tools and reagents (Link...
  8. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter... 26627737 Moffat PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat PSMD1 H. ... 26627737 Moffat PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat PSMB2 H. ... 26627737 Moffat EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat EIF3D H. ...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha 1...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...
  9. What's New in CRISPR - March 2020

    Type
    Blog Post
    ...Cas9-independent off-target DNA editing, ~5–50-fold lower levels of Cas9-dependent off-target DNA editing...repressor plasmids Cytosine base editors with minimized off-target DNA editing The original cytosine base editor...editor, BE3, induces a low frequency of genome-wide off-target DNA editing. Using several rapid and cost-... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...
  10. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression Jump to Top Photoswitchable (e.g. off to on to off) Protein Excitation (nm) Emission (nm) Brightness...Mammalian Expression Jump to Top Photoactivatable (e.g. off to on) Excitation and Emission wavelengths after ...eqFP611 559 611 35 Tetramer eqFP611-N1 - Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian...CYPet-C1 - Mammalian Expression AmCyan1 453 486 11 Tetramer AmCyan1-N1 - Mammalian Expression MiCy (Midoriishi-Cyan...Expression (cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1 530...Expression Kaede 508 / 572 518 / 580 87 / 20 5.6/5.6 Tetramer Kaede-N1 - Mammalian Expression Kaede-C2 - Mammalian...
  11. CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems

    Type
    Blog Post
    ...experiments 1. Reduce off-target effects Prolonged Cas activity can increase the chance of off-target editing...be used to limit this off-target editing, but when is the best time to shut off Cas activity? Using inhibitor... vectors. Having a way to shut off CRISPR-Cas systems prevents the off-target effects and cytotoxicity... to flip the switch and turn off CRISPR activity. The ability to turn off CRISPR activity is an important...there’s one thing that was missing: a way to shut off Cas’s activity. The concern is that the longer Cas...active in a cell, the greater chances there are for off-target edits to occur. Although methods to switch... drugs have been developed, the field lacked an “off-switch” for Cas proteins. Discovery of anti-CRISPR...
  12. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type
    Blog Post
    ...designed to improve on-target activity while reducing off-target effects in human genomes (Doench et al., 2016...based on their optimized sgRNA rules and potential off-target effects. The Dolcetto library contains two...previously established sgRNA rules and  potential on- and off-target effects. The 6 best sgRNAs were selected per...Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9." Nature biotechnology...while nuclease-deactivated Cas9 (dCas9) can be tethered to a repressor (CRISPRi) or an activation domain...RNA-guided DNA binding protein (dCas9). dCas9 is then tethered to a repressive domain, such as KRAB, to prevent...
  13. Better Dyeing Through Chemistry & Small Molecule Fluorophores

    Type
    Blog Post
    ... Other strategies that have been developed based off of this concept include: Self-labeling tags (e.g...cons All of these labeling strategies have trade-offs between the size of the genetically encoded tag,...discovered in 1856 by William Perkin. His discovery set off a flurry of activity and the majority of the classic...FlAsH, ReAsH) and a short genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins... lipoic acid ligase, biotin ligase, phosphopantetheinyltransferase) – These enzymes catalyze the covalent...1c). Click chemistry (e.g., transcyclooctene–tetrazine)– Nonnatural amino acids can be incorporated into...
  14. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ... typically achieve 90-99% knockdown with minimal off-target effects. The system also enabled them to turn...system. First of all, the Cas9s can be turned on and off, to reversibly activate or repress genes of interest...RNAs have different abilities to turn genes on and off,” he said. “Some are strong and some more moderate...where the degree to which genes are turned on and off varies depending on which guide RNA we use. What ...sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stem-loop 2; 3. The MS2-P65-HSF1 plasmid which...
  15. Viral Vectors 101: Optogenetic Tools

    Type
    Blog Post
    ... of light, with a different wavelength, turns it off, allowing the cell to be excited over a sustained...tools in their experiments. Some tools turn on and off rapidly with light to control precise timing of the...and activation kinetics Some channels turn on and off very rapidly in response to a single light pulse ...of how each tool performs and the consequences of off-target activity. Whether you are studying neuronal...photoswitchable tethered ligands (PTL), and photoswitchable, orthogonal, remotely-tethered ligands (PORTLs... secondary signaling pathways. Photoswitchable tethered ligands hold the ligand in close proximity to ...
  16. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ...TRICK (Translating RNA Imaging by Coat protein Knock-off) instead takes advantage of the ribosome’s movement...yellow. The act of translation pushes NLS-PCP-GFP off of the mRNA, leaving only a red FP bound to the reporter...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and is driven...of the PP7 and MS2 coat protein binding sites to tether many copies of the FP-coat protein fusions to their...these papers did. Since the SunTag-based system tethers mRNAs to the plasma membrane, it’s not appropriate...
  17. Lentiviral Guide

    Type
    Guide
    ...that can be included in transfer plasmids include: Tet- or Cre-based regulation and fluorescent fusions ...to the growth medium of the host cells, they kill off any cells that have not incorporated the lentiviral...cellular determinant is LEDGF/p75, a lentiviral tethering protein that recruits the pre-integration complex...experiments being performed, and your biosafety office can provide more information on your institution's...1998. 72(12): 9873-9880. PubMed . Retroviruses. Coffin JM, Hughes SH, Varmus HE. Cold Spring Harbor Laboratory...
  18. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ... In this system, light is used to turn “on” and “off” MEK1 activity by attaching two dimerizing photoswitchable... the Dronpa dimers interact and lock MEK1 in an “off” setting by blocking the active site. Dronpa also... thus indicates MEK1’s current state (Green when off, dark when on). Figure 1: Photoswitchable MEK1 (...psRaf1) followed by 3 seconds of 400 nm light (turn off psRaf1). After this, the phosphorylation status of...prone to aggregation in cells compared to the tetrameric Dronpa it was derived from. What are photoswitchable...
  19. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic...
  20. CRISPR Guide

    Type
    Guide
    ...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ...
Showing: 21 - 40 of 81 results