Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 23 results for: tetracycline resistance

Showing: 21 - 23 of 23 results

  1. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...including but not limited to cell growth and drug resistance. Recently, the Wu Lab at Texas Tech developed...vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting their...efficient approach to identify genes involved in drug-resistance. Remarkably, this method also enabled Lourido...proteasome subunit PSMB5 to find mechanisms of resistance to a proteasome inhibitor; CRISPR-X identified...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...

  2. Sequencing Primers

    Type
    Guide
    ...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

  3. Molecular Biology Reference

    Type
    Guide
    ...populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin) is included...providing a benefit to the host, such as antibiotic resistance. This benefit can be context-dependent, and thus...includes a DNA replication origin, an antibiotic-resistance gene, and a region in which exogenous DNA fragments... origin of replication ( ori ), an antibiotic-resistance gene, and at least one unique restriction enzyme...plasmids are convenient and easy to use. Antibiotic Resistance Gene Allows for selection of plasmid-containing... important to distinguish that the antibiotic resistance gene is under the control of a bacterial promoter...is typically in the form of another antibiotic resistance gene (this time, under the control of a non-bacterial...
Showing: 21 - 23 of 23 results