...for men. Not only does developing a drug in the current market cost billions—but when drugs fail, they ... relevant? Research shows that there are sex differences in the therapeutic capacity of stem cells. Yet...male stem cells. Nor did they detect important differences in function between male and female cells. The...in basic research.  In addition to the studies referenced above, another excellent resource for research...population. To learn a little more about where differences in effects on the sexes come from, one clue or...expert on gender in science and technology and currently directs the EU/US Gendered Innovations in Science...

... to what’s happening at different points within the wood. There are different types of cellulose fibers...number of DNA binding proteins with Cas9 guided by different promoters. The challenge in building genetic circuits...then you’d need the ability to turn on genes at different times. It requires more complex synthetic networks...circuits, they are extremely orthogonal. It’s a different perspective and you can layer them for more complicated...for multi-input CRISPR/Cas9 genetic circuits References: Nielsen AA, Voigt CA. Multi-input CRISPR/Cas...

... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

...for production of Gutless AdV can be found in reference 3. Production, amplification, and quality control...please see Addgene’s Adenoviral Guide webpage, and references 1, 2.*Pro-Tip*: once the correct recombinant ...specific for a viral DNA sequence. *Pro-Tip*: Ad5 reference material should be used as an internal control..., high-titer rAdV in your experiment. Enjoy! References 1. Luo, Jinyong, et al. "A protocol for rapid...practical guide for using the AdEasy System. 3. Jager, Lorenz, et al. "A rapid protocol for construction and ...  Karen Guerin...

...forms of these viruses typically used in research aren’t able to replicate, and for a virus to cross a synapse...Watabe-Uchida et al., 2012). They could also quantify the strength of the inputs by counting the monosynaptic inputs...more inputs than was previously thought. The differences in the inputs to each of the two populations ...populations could be used to explain the differences in the functions of these two neuronal populations. Overall...Overall, this study laid the foundation for how different anatomical regions of the brain receive inputs and...complex questions of how the brain operates. References 1. Callaway EM. Transneuronal Circuit Tracing...

...portal. The plasmids should be functional in many different human cell types, and while most of the genes ...protein from the untagged allele. Created with BioRender.com. The first step in creating the plasmids...GFP tag sequence to be inserted. Created with BioRender.com. A key feature of our methodology is the...enable us to effectively utilize the host cell’s inherent homology directed repair (HDR) process following...break and introducing the tag. Created with BioRender.com. Plasmids, plasmids everywhere To find out...Allen Institute website at alleninstitute.org. References 1. Roberts, Brock, et al. "Systematic gene tagging...

... and some, such as varenicline, are already approved for clinical use. Varenicline has been further modified...updated by Jason Nasse in July 2023.  References and Resources References Chen X, Choo H, Huang X-P, Yang X...to consider that the same receptor can elicit different responses depending on what cell type it is expressed... signaling. The two main classes of receptors currently used in chemogenetics are DREADDs and PSAMs. ...

...number, generally very small, and can contain different neurotransmitters. Using genetically encoded fluorescent... brain.  Figure 1:Schematic diagram of different FingR constructs and experimental results. Image... of the cell. By combining vectors expressing different fluorescent proteins targeting inhibitory or excitatory...The team validated this tool by targeting six different genes whose protein products have distinct localizations...Figure 2: Split-wrmScarlet labeling proteins with different subcellular locations. Image from Goudeau et al...consistently predicted the cell cycle speed across these different cell types. In one example, H2B-FT was expressed...

...order to head to Ireland and take a chance as entrepreneurs. To make things more interesting, we are working...academic labs. Being unable to publish or attend conferences makes it very challenging to compete in today...pressure to publish and more freedom to attend conferences, but after receiving her degree she was faced...ideas about things we could do for work, and they weren’t restricted to science jobs. Keira’s an optimist...career, but it was enough to start us down the entrepreneurial path. We threw some of our own money at this...thinking about making the switch from academia to entrepreneurship, share your thoughts with us in the comments...

...updated by Ina Ersing in August 2023 References and resources  References  Aurnhammer, C., Haase, M., Muether...required adenoviral helper genes are supplied on two different packaging plasmids: the pHelper plasmid containing...titering assay, you’ll need to understand how different titers are measured. A TCID50 measurement reports...have a high-quality plasmid standard and rAAV reference material of a known titer on every qPCR run. Note...of a recombinant adeno-associated virus type 2 Reference Standard Material. Human Gene Therapy, 21(10),...

...voltage indicators reviewed.   References and Resources   References Beck C, Zhang D, Gong Y. Enhanced... These types of sensors can have a variety of different components, but all contain a FRET pair, a genetic...specifically localize to the membrane, otherwise they aren’t all that useful. The cellular localization component...target – and this serotype can be selected to preferentially target your cell type of interest. Viral pseudotyping...powerful tool that swaps capsid proteins from different viruses to optimize them for targeting your cell...

...sequencing data. While “pictures” generated with current 3C methods provide useful information about chromatin...compare results across multiple targets because different CAPTURE cell lines will have varying levels of...lines Cell lines, primary cells Table 1: Key differences between original CAPTURE and CAPTURE 2.0 methods...that occur during development and cellular differentiation. Using a cell line model, the Xu Lab tracked...enhancer-promoter interactions during erythroid differentiation. CAPTURE 2.0 captures chromatin's dynamic role....0 re-writes the script on gene regulation. References Han, J., Zhang, Z., & Wang, K. (2018). 3C and...

...cellular pathways involved in the development of different cancers and identifying the roles of key proteins...approaching the Ras problem by exploiting the different mutant versions of Ras that are most prevalent...function of any of these genes through several different applications such as fluorescent protein fusion... study it (as seen in the screenshot below). Currently, the page includes interactive maps for the Ras...interests in education and scientific writing.     References 1. Martz, Colin A., et al. "Systematic identification... PMID: 24651010. 3. Ledford, Heidi. "The ras renaissance." Nature 520.7547 (2015): 278-280. PubMed PMID...

..., and he wisely makes no such attempt. He is transparent about his own biases--many of which will be shared...journal editorials, science social media, and conference workshops for years. That is, presumably, why... is the title of the chapter that examines the inherent brokenness of scientific publishing and research...off the section saying “science itself is never inherently bad or evil. However, it is easy to do sloppy...today--the day you are reading this review--in the current period of rapid flux, the chapter might still feel...scientist who enjoys learning a little bit about many different things (part of the reason Addgene has been such...

...Insertion of the mini-transposon can occur in two different orientations, but is strongly biased towards T-RL...integration efficiencies achieved with VchINT, at two different incubation temperatures. Data adapted from Vo ...and R ends - thus, scarless insertions are not currently possible, unlike methods involving homologous ...thanks to our guest blogger Leo Vo! Leo Vo is currently a PhD candidate in the Sternberg Lab at Columbia...Columbia University Medical Center. He currently studies CRISPR biology and CRISPR genome engineering technologies...Message or follow him on twitter @Vopinator.     References: Halpin-Healy TS, Klompe SE, Sternberg SH, Fernández...

...written by Addgenie Brian O'Neill.  References and resources References Bauzon, M., Castro, D., Karr, M.,...three (Servellita et al., 2023). Normally when children have acute viral hepatitis it is caused by the... the removal of certain adenoviral genes that apparently contribute to virulence (Tollefson et al., 1996...B. (2014). Adenoviruses: General Features. In Reference Module in Biomedical Sciences. Elsevier. https...Y. (2023). Adeno-associated virus type 2 in US children with acute severe hepatitis. Nature, 617(7961)...

...bottleneck in the experimental process. The majority of current cloning techniques involve the assembly of a circular...single PCR, for example for subcloning genes from different templates. All PCRs are run as an 18 cycle, 25... - 1 μl DpnI is added to the PCR mix to remove parental DNA (37 °C for 15 mins). This enzyme specifically...the MRC Laboratory of Molecular Biology. He is currently investigating the molecular biology of synaptic... on Twitter @jakefwatson and @JGarciaNafria.  References 1. Jones, Douglas H., and Bruce H. Howard. "A...for plasmid cloning Find our molecular biology reference here Find molecular biology protocols here   ...

...of green fluorescent protein (GFP) sparked a renaissance in biological imaging. Suddenly, cell biologists...dye (Figure 1a) and FAP systems (Figure 1e) are inherently fluorogenic and several others can be made fluorogenic... We continue to develop derivatives that have different spectral properties, exhibit high fluorogenicity...contributed by Luke D. Lavis. Luke D. Lavis is currently a Group Leader at the Janelia Research Campus,...modalities. Follow him on twitter @rhodamine110.   References 1. Liu, Zhe, Luke D. Lavis, and Eric Betzig. ...Imaging proteins inside cells with fluorescent tags." Trends in biotechnology 30.1 (2012): 8-16. PubMed PMID...

...Synthego has developed a new tool called ICE (Inference of CRISPR Edits) to solve this problem. This tool...efficiency and determine the profiles of all the different types of edits that are present and their relative...compares hundreds of samples simultaneously.  The current version of ICE software can analyze indels that...Adjacent Motif (PAM) sequence for the nuclease used. Currently, ICE is configured for Cas9 fromStreptococcus ...average amount of signal that disagrees with the reference sequence derived from the control trace file. ...cut site, representing a high level of sequence difference. Traces The Traces tab shows the edited and ...

...moving around to explore the environment has a different motivation (and brain areas associated) compared...addiction. Anxiety tests Rodents have a natural preference to stay in dark areas (protected) as opposed ...associated with psychiatric diseases such as schizophrenia or bipolar disorder. In both diseases, animals...these in a  future blog post, so stay tuned!  References Alpár, Alán, et al. "Hypothalamic CNTF volume...volume transmission shapes cortical noradrenergic excitability upon acute stress." The EMBO journal 37.21 ....12 (2007): 1079. PubMed PMID: 17700574. Hare, Brendan D., et al. "Optogenetic stimulation of medial prefrontal...