Skip to main content

We narrowed to 1,044 results for: REN

Showing: 811 - 840 of 1044 results
  1. Designing Your Chalk Talk for the Academic Job Interview

    Type
    Blog Post
    ... the Howard Hughes Medical Institute. Are you currently on or planning to go on the academic job market...if your model is correct or your data favor a different model. Finding evidence for or against a model...the answer to your research problem. Creating a coherent unified story and model can help make your ideas...
  2. Lab to Office Culture Shock

    Type
    Blog Post
    ...jarring for the unprepared, and unfortunately, there aren’t a lot of resources out there for scientists making...tight-knit team like that can and will be a little gut-wrenching, but you can get that feeling of camaraderie again...etc.--so everyone’s experience will be a little different. Some of these changes you may enjoy immediately...
  3. Bioinformatics at Addgene

    Type
    Blog Post
    ... has been crucial for us to keep pace with our current need to analyze nearly 300 sequences each week.... address the need to accelerate science using different approaches. We were also encouraged to see that...pipelines for genomic data. Thanks to the flexibility inherent in Nextflow’s design, we were free to use multiple...
  4. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...Gram-negative bacteria become resistant to antibiotics! References Espah Borujeni, Amin, Anirudh S. Channarasappa...engineering in bacteria using homologous recombination." Current protocols in molecular biology 106.1 (2014): 1-...for allelic exchange Read our molecular biology reference Watch molecular biology protocol videos ...
  5. Tips for Getting a Faculty Position

    Type
    Blog Post
    ...no papers, it's unlikely you'll get a job. The currency of scientific success is publications and grants...to convince me that their search committee is different and needs to be told all of the nuances of the...technologies, i.e. video interviews. For point of reference, I submitted my applications all by snail mail...
  6. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ... blog post on Easi-CRISPR for more details. References and resources Want to know more? Check out the...Genome Editing General Homologous Recombination References: Repair of Strand Breaks by Homologous Recombination...Cas-mediated Transgenesis (2018). Pubmed. CRISPR References: Genome engineering using the CRISPR-Cas9 system...
  7. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...to a mouse model of muscular dystrophy. Three different splice site donor and acceptor sequences were ...for a transgene to be reconstituted, there is currently no one ideal split vector system. Overall the ...greater and more consistent transgene expression. References: Allocca M, Doria M, Petrillo M, Colella P, Garcia-Hoyos...
  8. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...vegetable! What is an RNA aptamer? RNA is not inherently fluorescent and can be challenging to track intracellularly...similar properties to Broccoli despite binding to a different small molecule. Notably, like Broccoli, Red Broccoli...reports on the next additions to aptamer soup! References Alam, Khalid K., et al. "A fluorescent split ...
  9. Sequencing Primers

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence... Forward Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC...
  10. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...Reporter (iGluSnFR) designed and improved by the Loren Looger and Kaspar Podgorski Labs now has a new version...control of one of seven enhancers specific for different interneuron populations. The enhancers span all...effort to develop molecular tools for studying different brain cell types. Look for more of these interneuron-targeting...
  11. Generating Mouse Models Using CRISPR/Cas9

    Type
    Blog Post
    ...therapeutic applications that better human health.     References Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib... Does Not Require Ex Vivo Handling of Embryos. Current Protocols in Human Genetics 88: . https://doi.org...Models Using CRISPR‐Cas9‐Mediated Genome Editing. Current Protocols in Mouse Biology 6:39–66 . https://doi.org...
  12. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...Fast forward a few hundred years and there are currently about 5.5 million articles in the English version...a team is a really good way of creating and strengthening those social bonds. So never mind how much better... you find there’s a need for an expertise your current team members don’t have - sometimes you just don...
  13. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...click the "Save" button and jump around to the different pages by clicking on the appropriate boxes at ...at the bottom of the page before moving onto a different page so that any data you enter is not lost.   ...to the backbone, and the vector type. Pro Tip! Reference the Addgene ID in the "Backbone Manufacturer" ...
  14. Science Guides

    Type
    Guide
    ...Pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the...Find educational guides to learn more about the different types of viruses that are commonly used in research...
  15. New FLIS Plasmid (April Fools 2022)

    Type
    Blog Post
    ... this new technology as helpful as we have!  References and Resources Additional resources on the Addgene...Addgene blog:  Flies 101: Catching flies in the lab References Abril, U.N.O., et. al. (2022) A plasmid-based...
  16. SciComm with the Experts at Science in the News Part 1

    Type
    Blog Post
    ... the News hosts a podcast, seminars, a blog, conferences, and more for non-scientists. These programs ...Communicating with Non-Scientists How to Approach Different Audiences Listen to the SITN Podcast Many thanks...
  17. Celebrating the 2024 Nobel Prize in Chemistry

    Type
    Blog Post
    ...Top7 receives the Nobel Prize. Created with BioRender.com. Top7 gets its name from “topology of protein...David Baker, Demis Hassabis, and John Jumper! References Kuhlman, B., Dantas, G., Ireton, G. C., Varani...
  18. Podcast: A Malawian Professor's Path to Biotech Research

    Type
    Blog Post
    ...research. Listen to learn more about Dr. Kwapata’s current work and thoughts on the need for more scientific...biotech research in Malawi 11:41-14:53 : Kingdom's current projects producing transgenic crops 14:54-23:44...
  19. PEI Calculator for Planning AAV Packaging Transfections

    Type
    Blog Post
    ...the calculator in the comments section below. References 1. Choi, Vivian W., et al. "Production of Recombinant...Adeno‐Associated Viral Vectors for In Vitro and In Vivo Use." Current Protocols in Molecular Biology (2007): 16-25. PubMed...
  20. AAV Packaged on Request is Here!

    Type
    Blog Post
    ...repository to be packaged in your choice of five different serotypes.   We are so excited for all the ways... The AAV Packaged on Request banner.   We currently offer serotypes AAV1, AAV2, AVV5, AAV8, or AAV...
  21. Performing In Vivo CRISPR Screens Using the FITS Approach

    Type
    Blog Post
    ...activated T cells, precluding analyses of T cell differentiation beginning with naïve T cells. The Framework...improving CD8+ T cell responses to cancer.   References and resources Milling, L. E., Markson, S. C.,...
  22. Plasmid Grant to Aid Cervical Cancer Screening in Ghana

    Type
    Blog Post
    ... Cervical cancer screening in Ghana Gladys is currently working to enhance cervical cancer screening in...screening for HR HPV alongside the cytological tests currently in use. Gladys will use plasmids containing a ...
  23. Bringing Sustainable Practices to the Lab: Easy Action Items

    Type
    Blog Post
    ...sustainability problem, how can one little change make a difference? Individual changes to our behavior can lead ...energy, so even one less run a week makes a big difference. Clean out freezers so you can make room and ...
  24. Make a Splash: Notions of Scientific Impact Are Evolving

    Type
    Blog Post
    ...detailing Nobel Prize-winning research typically weren’t among the most cited. And, as scientific discourse...made of. Increasingly, journal publications alone aren’t enough. Scientists are sharing what they call “...
  25. A Scientist's Guide to Ebola

    Type
    Blog Post
    ...virus works its way into immune cells in ways that aren’t fully understood. Much of the action depends on...relevant scientific literature.  -In light of the current Ebola crisis, Science and Science Translational...
Showing: 811 - 840 of 1044 results