We narrowed to 1,038 results for: cat

... these stromal cell modifications, stromal cells are also constantly communicating with a tumor, proving... was contributed by Bárbara Pinho, a science communicator at the Portuguese science museum "Fábrica Centro...Proficient in transportation, exosomes are tools of communication and provide malignancy to the microenvironment... Pinho! Bárbara Pinho is currently a science communicator at the Portuguese science museum "Fábrica Centro...

...experiments. Recombinant AAVs (rAAVs) The primary application of AAV is delivery of genetic cargo to a host...numerical designations, separated by a slash, that indicate the ITR and serotype, respectively. For example...transduced gene is episomal and does not divide and replicate in the same way the host DNA does. Because of ... since you don’t have to wait for the host to replicate the DNA before expression. Now that you’ve got... S., et al. “Various AAV Serotypes and Their Applications in Gene Therapy: An Overview.” Cells, 12(5),...

...methods for identifying PPIs, such as affinity purification mass spectrometry (AP-MS), lack the ability ...the validation of a binary PPI as well as the identification of additional interacting factors. Problems...detect weak and/or transient PPIs. Many PPI identification techniques rely on protein interactors to stay... AP-MS. This requirement often prevents the identification of weak and/or transient interacting proteins...spatiotemporally defined protein complexes. Nature communications. PubMed PMID: 28585547. PubMed Central PMCID...

...including RNPs for indel formation via NHEJ, precise modification with Homology Directed Repair (HDR), CRISPR ...potential to be used for other types of CRISPR applications. Let’s take a look at the key components of ... which means they are non-infectious and non-replicative. Nanoblades are produced by transfecting the ...incubating Nanoblade particles with polybrene, a cationic polymer. Polybrene has long been used to increase...with Cas9-sgRNA ribonucleoproteins." Nature communications 10.1 (2019): 45. PubMed PMID: 30604748. PubMed...

...techniques that can be used to introduce genetic modifications into mouse embryos. But once you generate a ...techniques are each useful for introducing one modification into the mouse genome, they are not commonly...parental mice In order to ensure that your genetic modification will be passed along to all of the offspring...environment and will harbor similar epigenetic modifications. Special breeding cases Whether your mouse colony...the mutations that you are trying to cross are located on homologous chromosomes in the parental generation...

...stimuli. Cre recombinase catalyzes the recombination of DNA sequences located between two loxP sites. ...in research can fall under one of two broad classifications: inbred or outbred. Inbred strains share a ...Knockout mice Knockout mice have undergone genetic modification that alters or eliminates the expression of ...can be used to invert a segment of DNA or to translocate a piece of DNA from one region of the genome ...

...2021.   The potential tools fall into two categories: probes and editors. A probe array may consist...and should be varied as it can have important implications for the fusion protein effectivity), and a fluorescent...to visualize DNA, an editor targets DNA (via catalytically inactive dCas9) to modify chromatin. A fluorescent...both spatiotemporal protein degradation and quantification of this depletion using imaging-based measurements...BioTag, which can be used in protein affinity purification studies.    Duong et al., Genetics 2021. https...

...experiment and they don't do anything. Viruses are complicated and they perform complex biological tasks, both...vector may undergo genomic rearrangements during replication. To avoid genomic rearrangements, try amplifying...membranes (Davis et al., 2002). Polybrene is one such cationic reagent that is commonly used and has been shown... during transfection, and does not necessarily indicate the production of virus. Alternatively, if the...hepatitis B virus DNA and hepatitis C virus RNA quantification as measured with branched-DNA technology." ...

...functionality can be gained by understanding the location and transport of the protein within a living cell...to observe membrane trafficking events in vivo. Locate your protein and see who it is hanging out with...potential overlap, it is possible to determine the location of proteins within complex structures. In order...way it is important to choose the appropriate quantification methods and tools. It is usually not enough...intracellular pathogens In addition to tracking the location of proteins it is also possible to follow the ...

... (green or blue) within a population of timer indicates the age of the pool: the higher the ratio, the...-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT -  Applications of fluorescent protein timers FP timers have...biological event (trafficking to a subcellular location, start of gene expression, development of a cell... insulin-secreting beta-like cells." Nature communications 7 (2016). PubMed PMID: 27063289. PubMed Central...Learn More About Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your...

...been excitedly testing NgAgo's genome editing applications. So, how does NgAgo stack up thus far? A few...survey. When asked if they could detect indels (an indication of gene disruption ability) with NgAgo, one respondent...could not achieve indels with the NgAgo system indicates that it is very tricky to use and fussy to optimize... S. Lander, and Feng Zhang. "Development and applications of CRISPR-Cas9 for genome engineering." Cell...Addgene.org Request NgAgo Find CRISPR Resources Catch Up on Your CRISPR Background ...

...? Patron: Sainsbury has a mandate to share and educate and enable plant science in general. We are funded...easier because individual labs will not need to ‘domesticate’ all the basic and necessary elements in order... you are in the lab. There is no PCR, no gel purification; the whole cloning process is so simplistic ...tweet about plant synthetic biology, science communication, women in science, and many other topics. What...well-rounded human beings. It’s also a great communication tool for work. Most Sainsbury scientists are...

...Initiative. Endy's team made news in March with a publication in Science describing the development of “transcriptors...work, and it begins with the central dogma - replication of DNA, transcription of DNA to make RNA, translation..., humans have two types of languages: one to communicate amongst each other, like this conversation we... in English, and then there are languages to communicate with other things. These are programming languages...successful in the long term, if it's going to communicate between humans (i.e., our dreams and intentions...

...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...

...my job. The same can be said about teamwork, communication, writing, management, and creativity; I have...have the desired degree, you have mastered the applications they use, you’ve gained experience working with...to solve a problem. When they ask about your communication style, your potential teammates want to be assured...ve had to flex your conflict management and communication skills quite a bit. Grab a piece of paper and...Negotiation Career Planning Resources Cross team communication  External collaborators For further advice ...

...develop diverse fluorescent reporters is a useful application of high-throughput cloning. MXS Chaining is one...plasmids for fluorescence imaging or flow cytometry applications in mammalian cells. The modules used in this...transgene expression, or a variety of other clever applications. In one example, modular constructs generated...methods are suited for particular downstream applications. The tradeoffs between various cloning methods...technique to engineer various constructs with applications in flow cytometry approaches in mammalian cell...

... their organismal systems for scientists and educational programs for K-12 students. You can see why I...parenting strategies and make important ecological indicators since species live in water and on land. Current...which have been used to treat heart disease. Caterpillars that eat milkweed generate cardenolides that... poisonous) for bird predators - birds eat a caterpillar once, vomit, and never do it again. Cichlids ... expensive. They are using a cool fluorescent indicator system to rapidly identify recombinants. Arthropods...

...Addgene recently moved to our brand new location, with more space to grow and help scientists share resources... resources in new ways. Along with a new location comes the need for new conference room names. The Addgenie...transposon system including those from the original publication, Ivics et al 1997. Spaghetti Squash, a regulator...bunch of cookie monster eyes.”  Check out the publication to see for yourself. We have one plasmid in our...Bodmer, Rolf. "The gene tinman is required for specification of the heart and visceral muscles in Drosophila...

...positioned like Cas12a PAM sites. For Cas9, the PAM is located just downstream (3′ end) of the target sequence...-strand breaks like those created by Cas12a. Applications of TnpB One of the major challenges in genome...5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 (specific to your target...viral vectors and for multiplexed gene editing applications. As research into TnpB continues to evolve, ...elaborate protocols are available in our earlier publications (Karmakar et al., 2024; Karmakar et al., 2025...

...performs well in many different antibody-based applications.  IPI’s recombinant version is a fusion of mouse...with additional cofactors or using significantly truncated forms that limit its functionality. To make biophysical...cellular processes in C. elegans: mScarlet3 for applications needing intense brightness (such as low-expression...luciferase fragment (expressed separately) assemble and catalyze the luminescence reaction (Figure 5). The researchers...under tension. Upon binding, LgBiT and BiT Tag catalyze a luminescent reaction with the substrate furimazine...