Skip to main content
Addgene

We narrowed to 649 results for: CHI

Showing: 621 - 640 of 649 results
  1. CRISPR Guide

    Type
    Guide
    ...Purify Genomic Regions The enChIP (engineered DNA-binding molecule-mediated ChIP) system, developed by the...the DNA, to create a DSB enChIP En gineered DNA-binding molecule-mediated ChIP , using a tagged-dCas9+gRNA...the ways the CRISPR components are leveraged to achieve specific goals, such as targeting multiple genomic...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...gRNAs into a single plasmid — though some have achieved targeting in the double digits. These multiplex...nickase system is utilized in many CRISPR systems to achieve specific genetic edits. The dCas9 molecule binds...or G, Y = C or T SpRYc - SpRY PAMs plus NNG; a chimeric version of SpRY Though these PAM-flexible Cas9s...
  2. Antibody Guide

    Type
    Guide
    ... Special considerations One type of ChIP assay, called native ChIP, does not use cross-linking and instead...accessible to antibodies. Detection of sdAbs is usually achieved by conjugation of a signaling molecule directly...can be detected either digitally by an imaging machine or by X-ray film. HRP cannot be used to distinguish...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - used to visualize protein location...either X-ray film in a darkroom or an image capture machine. Special considerations The primary antibody must...immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate specific proteins or protein...
  3. Antibodies 101: Validation

    Type
    Blog Post
    ... it’s important to know what you are aiming to achieve. In general, these are three core goals of antibody...
  4. Optogenetics Guide

    Type
    Guide
    ...channels- chimeras C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and...genetic point mutations, codon optimization, and chimeric fusion of domains from two different ChRs. These...photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA...and ChR2 450-470 C1V1 ChR1-VChR1 chimera with E122T and E162T mutations 540 Channelrhodopsins: chloride...inhibitory ChR with mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia...Generally, the most robust and stable expression is achieved in a transgenic mouse line, such as for example...targets into large, optically assembled protein architectures in living mammalian cells. LITE Two-hybrid system...
  5. Sequencing Primers

    Type
    Guide
    ...reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward...forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R,...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ...
Showing: 621 - 640 of 649 results