...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ...toxic or insoluble proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin...glutathione reductase to faciliate proper folding; may increase multimer formation Δ(ara-leu)7697 ΔlacX74 ΔphoA... General protein expression  m15 pREP4*, ** Kanamycin (pREP4) Cis-repression of the E. coli T5 promoter...salts may be preferable if the protein product is secreted to the medium or if slow expression is required...required due to solubility concerns. Insoluble and Secreted Proteins: The most common purification protocols...

...developing zebrafish pancreas. They first tagged these cells using plasmids. Then using HOTcre, a method that...of quiescent and proliferative pancreatic β-cells identified by HOTcre mediated labeling." Proceedings...researchers: the mouse (Mus musculus). Mice have many advantages as a mammalian model organism for scientists ...You can find these plasmids at Addgene. Another advantage of mice as model organisms is that they are genetically...in the fly (Pandey and Nichols, 2011). A huge advantage of using the fruit fly is the array of genetic...these systems check out Gerald Rubin’s lab who created a set of modular vectors that can be used to optimally... of the fly (Pfeiffer et al., 2010). Yeast (Saccharomyces cerevisiae) Yeast, one of the simplest eukaryotic...

...KB Fujii iChIP/enChIP to purify genomic DNA FLAG tagged dCas9 PDF 107.4 KB Goldstein Nematode: gRNA design...pCFJ90 (pharyngeal co-injection marker); pDD104 (Cre recombinase) PDF 102.5 KB Jaenisch CRISPR plasmid...PDF 106.7 KB Mendenhall & Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor ; additional HDR.... Green Listed - a CRISPR Screen Tool Design gRNAs for custom CRISPR screens targeting a long or short...labs who have deposited CRISPR plasmids , we've created a series of links and guides to help you use CRISPR...considerations, and more. CasPEDIA is a community resource created and maintained by the Doudna Lab at the Innovative... and quantify the efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can ...

...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...titration with finer increments of puromycin to determine a more precise optimal puromycin concentration.) ...transforming into bacteria D. Screening for Inserts D.1 Recommended materials D.2 Screening for inserts E. Producing...kinase promoter drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO...greater yield of DNA. Back to Top D. Screening for Inserts You may screen for plasmids that were successfully...sulfate, and puromycin are located in the “Appendix”. F.2. Determining the Optimal Puromycin Concentration...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...

...Addgene is certainly going to have to find ways to tag and curate reagents from these emerging organisms... progress on the NSF “G to P grand challenge.” Creating a productive, new scientific community is no small...in particular, that they all share the plasmids created under this programs via Addgene. New organisms ...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...-  perhaps you’ll choose to study Crepidula atrasolea or Prochlorococcus with your next project. Gymnotiformes...crisis. I like how they are using protocols.io to create a protocol community! Asclepias syriaca and Asclepias...used to study aspects of cognition. Spiralians - Crepidula atrasolea (Jonathan Henry) This black footed slipper...

...cloned into an IPTG-inducible His-tag expression vector. All His-tags are cloned at the C-terminus of ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular biology...a TEV cleavage site is present between the 6xHis-tag and the coding region of MDH. For detailed clone ...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic.... PMID: 36893201 (Link opens in a new window) Increasing access for biochemistry research in undergraduate...

... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...EGFP Del Bene pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2 74010 Zebrafish U6 yes, cut S. pyogenes Cre Del Bene pTE4396...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes... pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV ...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S. pyogenes...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pMB70 47943 Worm...

...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV2394 107788-AAV9 AAV.rTH.PI.Cre.SV40 Cre Recombinase... Cre Recombinase James M. Wilson AV-5-PV2408 105550-AAV5 pAAV.GFAP.Cre.WPRE.hGH Cre Recombinase James ...AAV.TBG.PI.Cre.rBG Cre Recombinase James M. Wilson AV-8-PV2004 105545-AAV8 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase... 0.4.Cre.SV40 Cre Recombinase James M. Wilson AV-1-PV2676 105553-AAV1 pENN.AAV.hSyn.Cre.WPRE.hGH Cre Recombinase...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-5-PV2396 105558-AAV5 pENN.AAV.CamKII 0.4.Cre.SV40 Cre...James M. Wilson AV-1-PV1090 105537-AAV1 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-1-PV1848...PV1848 105540-AAV1 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-1-PV2004 105545...

...Includes tagging with CFP, YFP, and mRFP Tsoulfas Lab Lentiviral Plasmids - Fluorescently tag your gene...plasmid backbones with different fluorescent tags for you to create fusion proteins with your gene of interest... iRFP Gradia Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab ...C. elegans Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95... expression Yeast Thorn Lab Vectors - Includes tagging with a wide variety of colors, some specifically...Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia...

... (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope tags or fluorescent...protein tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety... not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also be used to purify a genomic locus... EM, Myers RM. 2015. CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res . ...with work directed towards increasing on-target editing rates and decreasing off-target editing rates. ... locus makes it especially amenable to genetic screens. Pooled gRNA libraries can be used to identify ...sequencing, CRISPR is a robust system for genome-wide screening. CRISPR Technological Advances CRISPR technology...

...of gene of interest with Strep-Tag and Tet-On 3G transactivator, creating an auto-regulated Tet-On 3G System...cassette in format: PGK-rtTA-2A-puro; see article for tagged insert options rtTA On Root 11651 pLVUT-tTR-KRAB...inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin selection TetR On Wiederschain...tetracycline-controlled transactivator (tTA) was developed. tTA was created by fusing tetR with the C-terminal domain of VP16...tTA binding to the tetO sequences and subsequent increase in expression by the activation domain, resulting...On System In 1995, Gossen et al. used random mutagenesis to identify which amino acid residues of tetR...repressor, or rTetR, which reversed the phenotype and created a reliance on the presence of tetracycline for ...

... pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns on shRNA expression...expression. See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP... genome, it has the potential for insertional mutagensis. The 2nd and 3rd generation lentiviral systems...systems available at Addgene have been designed for increased researcher safety. Read our Lentiviral Guide for...22502 pCEP4-tat N/A Packaging Expression of tat; increases viral titer Kasparov 22501 pHEF-VSVG N/A Envelope...-pLKO-puro 3rd inducible expression of shRNA; puromycin selection. See plasmid 21916 for Neo selection...cDNA expression, gateway plasmid, constitutive Hygromycin resistance gene coexpression. See article for...

...63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian ...Conditional overexpression plasmid; deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and...cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE...results in long-term transgene expression. Some disadvantages of γ-retroviruses are that they can only transduce... can lead to oncogenesis (termed insertional mutagenesis). Read our γ-Retrovirus Guide for more information...largeTcDNA MoMLV Expression of Large T antigen for creation of immortalized cells (see Weinberg Lab page for...pBABE-hygro-hTERT MoMLV Expression of hTERT for creation of immortalized cells; additional plasmids include...

... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...an anti-FLAG antibody to immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9... in the DNA. Indels often lead to frameshifts, creating loss of function alleles. To introduce specific...adenine to inosine, which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations...breaks in DNA instead of the double-strand breaks created by wild type Cas enzymes. To use a nickase mutant...your DNA in close proximity. These double nicks create a double-strand break (DSB) that is repaired using...fused to a transcriptional activator peptide can increase transcription of a specific gene. Design your ...

...LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These Cre/ FLP versions are retained in the...control without modification - either Cre is there or it’s not. Cre-mediated possibilities for site specific...control FLP and Cre expression have been developed. Read on to learn more about FLP-FRT, Cre-lox, and how...the control of Cre recombinase are used in combination with mouse lines that express Cre only in the cell...Tamoxifen inducible Cre versions can be used in these experiments. This elegant combination of Cre, FLP, and inducible...about Cre-Lox Check out Retrograde AAVs for Neurscience Research Resources on Addgene.org Find Cre-Lox...contributed by guest blogger Katrin Michel. Cre-lox is an incredibly popular and powerful site specific recombinase...

...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...

...Slow transformation   Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis.... Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability (streptomycin), doesn’t work for... for transformations. Con: Expensive.   Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits...Like carb, spectinomycin is the more stable and expensive antibiotic compared to streptomycin. Spectinomycin...cleavage in human cells. Mutagenesis, 20(2), 111–114. https://doi.org/10.1093/mutage/gei016I Resources on ... plates due to the fact that beta-lactamase is excreted. Satellite colonies are small colonies of bacteria...Spectinomycin/streptomycin can be successfully used for plant and bacterial culture, but some types of bacteria...

...likelihood of multiple integration events decreases as the dilution increases. Calculate the transduction units...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and... remove cells and debris. Lentiviral titer can decrease during cycles of freeze-thaw. If you are freezing...

... baseline voltage), the investigators found that administering these AAVs with a dilute Cre-expressing... Ace2N-mNeon-A122D and Voltron2 are available as Cre-dependent AAV1 vectors and are suitable for extended...CRISPR screens By Emily Bentley Building on their CROPseq method for optical pooled CRISPR screening, Paul...pooled screens in human cells. Addgene offers vectors for CROPseq-multi using selection by Puromycin, Zeocin...Voltron2 voltage sensors By Brian O’Neill New viral vector preps expressing the Voltron2 voltage indicator...variant has increased signal-to-noise ratio and better ability to record subthreshold voltage fluctuations...Multiplexed perturbation and decoding in pooled CRISPR screens Improved prime editor PE7 Antibodies to facilitate...

... as opposed to transiently-transfected cells, increases reproducibility, as it eliminates the variation...deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene...preparation Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ... 55 mL of heat-inactivated FBS and 5mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and FBS...obtaining accurate results. Check the cells for mycoplasma (Link opens in a new window) regularly Do not...