Skip to main content
Addgene

We narrowed to 103 results for: Myc-tagged Cre

Showing: 61 - 80 of 103 results
  1. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ...uracil DNA glycosylase inhibitor and degradation tag on the fusion protein to limit the activity of the... lab created two “pCRISPomyces” systems for use in Streptomyces (Cobb et al., 2015). pCRISPomyces-1 includes...other advantages including shorter plasmid curing time. pCRISPomyces for editing in Streptomyces  Streptomyces...array, while pCRISPomyces-2 contains Cas9 and a gRNA cassette. The simpler system of pCRISPomyces-2 displays...proteotoxic when used in Mycobacterial species, Sarah Fortune’s lab screened 11 other Cas9 orthologs to...for transcriptional silencing Mycobacterium tuberculosis and Mycobacterium smegmatis. In addition to their...Addgene depositor Luciano Marraffini’s lab took advantage of this lethality to design the first synthetic...
  2. Plasmids 101: E. coli Strains for Protein Expression

    Type
    Blog Post
    ...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ...toxic or insoluble proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin...glutathione reductase to faciliate proper folding; may increase multimer formation Δ(ara-leu)7697 ΔlacX74 ΔphoA... General protein expression  m15 pREP4*, ** Kanamycin (pREP4) Cis-repression of the E. coli T5 promoter...salts may be preferable if the protein product is secreted to the medium or if slow expression is required...required due to solubility concerns. Insoluble and Secreted Proteins: The most common purification protocols...
  3. Five Popular Model Organisms

    Type
    Blog Post
    ...developing zebrafish pancreas. They first tagged these cells using plasmids. Then using HOTcre, a method that...of quiescent and proliferative pancreatic β-cells identified by HOTcre mediated labeling." Proceedings...researchers: the mouse (Mus musculus). Mice have many advantages as a mammalian model organism for scientists ...You can find these plasmids at Addgene. Another advantage of mice as model organisms is that they are genetically...in the fly (Pandey and Nichols, 2011). A huge advantage of using the fruit fly is the array of genetic...these systems check out Gerald Rubin’s lab who created a set of modular vectors that can be used to optimally... of the fly (Pfeiffer et al., 2010). Yeast (Saccharomyces cerevisiae) Yeast, one of the simplest eukaryotic...
  4. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Plasmid Collections Recombinases Cre-Lox and Other Site-Specific Recombinases Cre Plasmids Flp Plasmids Dre ...prevent gene expression in the absence of Cre. In the presence of Cre, the stop codon is excised, and gene ...until Cre is present, at which time the gene will be disrupted or deleted. shRNA Expression: Cre-lox can...interest, Genes A and B. When Cre is absent, only Gene A is translated correctly. Cre expression excises Gene...double-crossover event. Toxicity Cre-lox recombination is a very useful tool, but Cre expression can be toxic ... such as Cre-only lines to account for cellular toxicity in your system. Using inducible Cre systems in...expressing Cre and other site-specific recombinases. Many of our in-stock viral preps feature Cre-dependent...
  5. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...found in Botman et al., 2019 . FP Tagging Yeast tagging vectors to create fusions of proteins of interest...Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https...plasmids to overexpress various fluorescent markers and tag your proteins of interest with fluorescent proteins...Collection Botman-Teusink Yeast FP Collection FP Tagging FP Overexpression Resources This comprehensive ...allows for constitutive overexpression of FPs and tagging of genes of interest with FPs in yeast. Characterization...TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication FP Overexpression Plasmids for constitutive...Improved blue, green, and red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902...
  6. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...titration with finer increments of puromycin to determine a more precise optimal puromycin concentration.) ...transforming into bacteria D. Screening for Inserts D.1 Recommended materials D.2 Screening for inserts E. Producing...kinase promoter drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO...greater yield of DNA. Back to Top D. Screening for Inserts You may screen for plasmids that were successfully...sulfate, and puromycin are located in the “Appendix”. F.2. Determining the Optimal Puromycin Concentration...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...
  7. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...Addgene is certainly going to have to find ways to tag and curate reagents from these emerging organisms... progress on the NSF “G to P grand challenge.” Creating a productive, new scientific community is no small...in particular, that they all share the plasmids created under this programs via Addgene. New organisms ...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...-  perhaps you’ll choose to study Crepidula atrasolea or Prochlorococcus with your next project. Gymnotiformes...crisis. I like how they are using protocols.io to create a protocol community! Asclepias syriaca and Asclepias...used to study aspects of cognition. Spiralians - Crepidula atrasolea (Jonathan Henry) This black footed slipper...
  8. CRISPR References and Information

    Type
    Collection
    ...KB Fujii iChIP/enChIP to purify genomic DNA FLAG tagged dCas9 PDF, 110 KB Goldstein Nematode: gRNA design...pCFJ90 (pharyngeal co-injection marker); pDD104 (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid ...PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor ; additional HDR...- a CRISPR Screen Tool (Link opens in a new window) Design gRNAs for custom CRISPR screens targeting a...in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's downloadable eBook about...CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation, inhibition...For use with genome-scale CRISPR-Cas9 knockout screens (or GeCKO) technology. Developed by the Xiaole ...
  9. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...EGFP Del Bene pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2 74010 Zebrafish U6 yes, cut S. pyogenes Cre Del Bene pTE4396...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes... pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV ...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S. pyogenes...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pMB70 47943 Worm...
  10. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...cloned into an IPTG-inducible His-tag expression vector. All His-tags are cloned at the C-terminus of ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular biology...a TEV cleavage site is present between the 6xHis-tag and the coding region of MDH. For detailed clone ...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic.... PMID: 36893201 (Link opens in a new window) Increasing access for biochemistry research in undergraduate...
  11. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV2394 107788-AAV9 AAV.rTH.PI.Cre.SV40 Cre Recombinase... Cre Recombinase James M. Wilson AV-5-PV2408 105550-AAV5 pAAV.GFAP.Cre.WPRE.hGH Cre Recombinase James ...AAV.TBG.PI.Cre.rBG Cre Recombinase James M. Wilson AV-8-PV2004 105545-AAV8 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase... 0.4.Cre.SV40 Cre Recombinase James M. Wilson AV-1-PV2676 105553-AAV1 pENN.AAV.hSyn.Cre.WPRE.hGH Cre Recombinase...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-5-PV2396 105558-AAV5 pENN.AAV.CamKII 0.4.Cre.SV40 Cre...James M. Wilson AV-1-PV1090 105537-AAV1 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-1-PV1848...PV1848 105540-AAV1 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-1-PV2004 105545...
  12. Lentivirus Plasmids

    Type
    Collection
    ... pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns on shRNA expression...expression. See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP... genome, it has the potential for insertional mutagensis. The 2nd and 3rd generation lentiviral systems...systems available at Addgene have been designed for increased researcher safety. Read our Lentiviral Guide for...22502 pCEP4-tat N/A Packaging Expression of tat; increases viral titer Kasparov 22501 pHEF-VSVG N/A Envelope...-pLKO-puro 3rd inducible expression of shRNA; puromycin selection. See plasmid 21916 for Neo selection...cDNA expression, gateway plasmid, constitutive Hygromycin resistance gene coexpression. See article for...
  13. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Includes tagging with CFP, YFP, and mRFP Tsoulfas Lab Lentiviral Plasmids - Fluorescently tag your gene...plasmid backbones with different fluorescent tags for you to create fusion proteins with your gene of interest... iRFP Gradia Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab ...C. elegans Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95... expression Yeast Thorn Lab Vectors - Includes tagging with a wide variety of colors, some specifically...Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia...
  14. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope tags or fluorescent...protein tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety... not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also be used to purify a genomic locus... EM, Myers RM. 2015. CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res . ...with work directed towards increasing on-target editing rates and decreasing off-target editing rates. ... locus makes it especially amenable to genetic screens. Pooled gRNA libraries can be used to identify ...sequencing, CRISPR is a robust system for genome-wide screening. CRISPR Technological Advances CRISPR technology...
  15. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These Cre/ FLP versions are retained in the...control without modification - either Cre is there or it’s not. Cre-mediated possibilities for site specific...control FLP and Cre expression have been developed. Read on to learn more about FLP-FRT, Cre-lox, and how...the control of Cre recombinase are used in combination with mouse lines that express Cre only in the cell...Tamoxifen inducible Cre versions can be used in these experiments. This elegant combination of Cre, FLP, and inducible...about Cre-Lox Check out Retrograde AAVs for Neurscience Research Resources on Addgene.org Find Cre-Lox...contributed by guest blogger Katrin Michel. Cre-lox is an incredibly popular and powerful site specific recombinase...
  16. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    ...Slow transformation   Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis.... Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability (streptomycin), doesn’t work for... for transformations. Con: Expensive.   Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits...Like carb, spectinomycin is the more stable and expensive antibiotic compared to streptomycin. Spectinomycin...cleavage in human cells. Mutagenesis, 20(2), 111–114. https://doi.org/10.1093/mutage/gei016I Resources on ... plates due to the fact that beta-lactamase is excreted. Satellite colonies are small colonies of bacteria...Spectinomycin/streptomycin can be successfully used for plant and bacterial culture, but some types of bacteria...
  17. Retrovirus Plasmids

    Type
    Collection
    ...63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian ...Conditional overexpression plasmid; deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and...cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE...results in long-term transgene expression. Some disadvantages of γ-retroviruses are that they can only transduce... can lead to oncogenesis (termed insertional mutagenesis). Read our γ-Retrovirus Guide for more information...largeTcDNA MoMLV Expression of Large T antigen for creation of immortalized cells (see Weinberg Lab page for...pBABE-hygro-hTERT MoMLV Expression of hTERT for creation of immortalized cells; additional plasmids include...
  18. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...an anti-FLAG antibody to immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9... in the DNA. Indels often lead to frameshifts, creating loss of function alleles. To introduce specific...adenine to inosine, which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations...breaks in DNA instead of the double-strand breaks created by wild type Cas enzymes. To use a nickase mutant...your DNA in close proximity. These double nicks create a double-strand break (DSB) that is repaired using...fused to a transcriptional activator peptide can increase transcription of a specific gene. Design your ...
  19. Validated gRNA Sequences

    Type
    Collection
    ...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...
  20. Colony Formation Titering Assay

    Type
    Protocol
    ...likelihood of multiple integration events decreases as the dilution increases. Calculate the transduction units...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and... remove cells and debris. Lentiviral titer can decrease during cycles of freeze-thaw. If you are freezing...
Showing: 61 - 80 of 103 results