Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 91 results for: c myc

Showing: 61 - 80 of 91 results

  1. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...thymine, cytosine, and guanine (abbreviated to A, T, C, and G respectively) that are organized into a double...1000X stock solutions and storing aliquots at -20°C. To use, dilute your antibiotic into your LB medium...complementary, strand. Specifically, A pairs with T and C pairs with G. During replication, DNA unwinds and ...

  2. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    ...these methods a try.  References Højland Knudsen C, Ásgrímsdóttir ES, Rahimi K, Gill KP, Frandsen S, ...stably integrate a reporter gene that contains a puromycin resistance gene followed by the target site (the...genome edit:  A donor plasmid that contains a puromycin resistance gene linked to an in-frame H2B-GFP....

  3. Validated gRNA Sequences

    Type
    Collection
    ...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...

  4. Tetracycline Inducible Expression

    Type
    Collection
    ...for Tet transregulators. Krueger C, Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546...developed. tTA was created by fusing tetR with the C-terminal domain of VP16 (virion protein 16), an essential...encoded tetracycline resistance. Hillen W and Berens C. Annu Rev Microbiol . 1994;48:345-69. PubMed . Transcriptional...cells. Yao F, Svensjö T, Winkler T, Lu M, Eriksson C, Eriksson E. Hum Gene Ther . 1998 Sep 1;9(13):1939...biomedical research. Bockamp E, Maringer M, Spangenberg C, Fees S, Fraser S, Eshkind L, Oesch F, Zabel B. Physiol...inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin selection TetR On Wiederschain...from pCW57.1. rtTA was replaced with tTA, and Puromycin was replaced with Blasticidin selection. Please...

  5. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...the mitochondrial targeting sequence of cytochrome c oxidase subunit VIII, so that they can be imported...pCoofy series of plasmids contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep, CBP...N-terminal tag, coding sequence of the gene of interest, C-terminal tag, plant terminator, and plant resistance... The strategy relies on several observations: Rapamycin is a membrane-permeable pharmacological agent ...induction heterodimerization of proteins that contain rapamycin-binding domains, such as FKBP and FRB. The cell...membrane protein with a FRB domain (MitoTRAP). Rapamycin binds your recombinant protein (via FKBP) and ...

  7. Tips for arabidopsis transformation

    Type
    Blog Post
    ...be used for promoter swapping and generating N and C terminally tagged fusion proteins with fluorescent... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...

  8. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...2.50021-0  Toh, W. K., Teo, Y. L., Tor, X. Y., Loh, P. C., & Wong, H. L. (2023). Development of constitutive...Gluconacetobacter xylinus, Haemophilus influenzae, Hypomycrobium X, Legionella pneumophila, Methylophilus methyltrophus...calcoaceticus, Actinobacillus pleuropneumoniae, Actinomyces naeslundii, A. viscosus, Aerobacter aerogenes...Methylophilus methylotrophus, Moraxella spp., Mycobacterium aurum, M. smegmatis, Paracoccus denitrificans...spheroides, Salmonella spp., Serratia marcescens, Streptomyces lividans, Synechococcus spp., Thiobacillus ferrooxidans...

  9. Viral Production

    Type
    Collection
    ...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...Control Mycoplasma The 293T cell line was obtained from Takara, and is routinely tested for mycoplasma contamination... tested for mycoplasma contamination. To date, Addgene has never had a case of mycoplasma contamination...contamination using mycoplasma detection kits. The cell line is maintained for ~20 passages before being...

  10. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal mCherry for C. elegans...GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C. elegans Hamdoun Lab Plasmids...mNeonGreen 506 517 93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Jump to Top ...pmScarlet_C1 - Mammalian Expression pCS2+mScarlet-C Cloning Vector - Mammalian Expression mScarlet-I 569...mCerulean Davidson Lab Plasmids - Includes many N- and C-terminal fluorescent proteins Insect Sutherland Lab...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab...

  11. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pyogenes Zhang PX854 62886 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang pGuide 64711 Mammalian ...pyogenes Zhang PX852 62884 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang PX855 62887 Mammalian BbsI...pyogenes Zhang PX856 62888 Mammalian BbsI yes, activate, C-terminal S. pyogenes Zhang pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pMB70 47943 Worm...

  12. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...inducing a DNA break. Cytosine base editors convert C->T (or G->A on the opposite strand) within a small...which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Promoter...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9...

  13. CRISPR Plasmids - Plants

    Type
    Collection
    ...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...inducing a DNA break. Cytosine base editors convert C->T (or G->A on the opposite strand) within a small...which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids...

  15. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...

  16. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting...Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage...., R is a purine (A,G), and Y is a pyrimidine (C,U). G-C content should be 36-52%. Sense 3’ end should ...annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning vector from step C.3 (If you were unable ...Store at 4°C. m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO ...at 37°C, 5% CO 2 overnight. Day 2: b. The target cells should be approximately 80-90% confluent. c. Dilute...solution is stable at 4°C for up to one year. The powder form of polybrene is stable at 4°C for several years...

  17. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...system and its dynamics. References 1. Peters, Nathan C., et al. "In vivo imaging reveals an essential role...during the development and disintegration of mycobacterial granulomas." Immunity 28.2 (2008): 271-284. ...presentation and T cell effector function in mycobacterial granulomas." Immunity 34.5 (2011): 807-819. ...

  18. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ... easy for a researcher to quickly generate N- and C-terminal epitope tag fusions to a protein of interest...et al. "Adaptation of Enterococcus faecalis to daptomycin reveals an ordered progression to resistance....

  19. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...

  20. mTOR Pathway

    Type
    Collection
    ...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53 PDK1 Pyruvate dehydrogenase...10.1016/j.cell.2012.03.017. PubMed PMID: 22500797 . Rapamycin: one drug, many effects. Li J, Kim SG, Blenis ...
Showing: 61 - 80 of 91 results