Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 73 results for: gag pol

Showing: 61 - 73 of 73 results

  1. Finding and Joining Your Dream Lab

    Type
    Blog Post
    ...or contract, you should be starting to send out polite emails with your CV to people you’d like to work...scientists and technical people) is linked to engagement and access to growth opportunities, not salary...

  2. Communicating Your Science With Help From ComSciCon

    Type
    Blog Post
    ... from audiences as they do science outreach and engage with the public, and learn from the process of ...broader impacts for their work in education and policy and to draw attention and support to work in their...

  3. Design Tips for Prime Editing

    Type
    Blog Post
    ...Editing the PAM prevents the prime editor from re-engaging with DNA it has already edited. Created with BioRender.com... La to protect the end of the pegRNA. Adding 3′ polyU tracts to the end of pegRNAs (but not epegRNAs) ...

  4. xCas9: Engineering a CRISPR Variant with PAM Flexibility

    Type
    Blog Post
    ...engineered SpCas9 variants with alternative PAMs like NGAG and NGCG and SaCas9 with an NNGRRN PAM by mutagenizing...catalytically dead SpCas9 (dCas9) fused to the bacterial polymerase subunit ω. This construct is designed to activate...

  7. The Challenges of Cell Culture

    Type
    Blog Post
    ...sharing cells: the black market of cell biology. Engaging in this practice would seem to save time and money...whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique is...

  8. Antibodies 101: Single Chain Fragment Variables (scFvs)

    Type
    Blog Post
    ...recombinant antibody. They are ~25 kDa single polypeptides that contain the variable light chain (VL) and...When these molecules, called Bispecific T-cell engagers (BiTE®s), bind CD3 on T cells and a tumor-specific...

  9. CRISPR Guide

    Type
    Collection
    ...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...

  10. A Guide to Getting Started in Undergrad Research

    Type
    Blog Post
    ...lab Writes a lot of grants Varying degrees of engagement with what happens in the lab Official title is...dedicated to different career options from science policy to science communication and much more. I hope ...

  12. Sequencing Primers

    Type
    Guide
    ..., reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward...TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 ...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...

  13. CRISPR Guide

    Type
    Guide
    ...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...
Showing: 61 - 73 of 73 results