Skip to main content

We narrowed to 1,044 results for: ren

Showing: 801 - 820 of 1044 results
  1. Plasmids 101: Protein Expression

    Type
    Blog Post
    ...these vectors is controlled by a different promoter resulting in different levels of expression from each...labelled or modified amino acids that are useful in different downstream applications. Cell-free expression ...
  2. Quick Guide to Working with Drosophila Part 1: Getting Started with Flies

    Type
    Blog Post
    ... the heat. Isolating male and female flies Differentiating male and female flies is essential for setting...their adult phase. It is important to clear out the parent crosses from the container before the progeny begin...thorax to look like stubble (sb). For a better reference of various fly phenotypes, check out the Classical...
  3. Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells

    Type
    Blog Post
    ...image provided by Manuel Gonçalves; made with BioRender.   Delivering gRNA and Cas9 using adenoviral...and CRISPR resources on Addgene's CRISPR page. References Beatty MS, Curiel DT (2012) Adenovirus Strategies...Zamyatnin AA Jr (2016) Viral vectors for gene therapy: Current state and clinical perspectives. Biochemistry Moscow...
  4. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...AstraZeneca. Why I chose an industry postdoc I’m currently doing an industry postdoc in neuroscience at AstraZeneca... the process is similar to academia. The only difference is that your paper will be reviewed by an internal...blogger, Laura Desrochers! Laura Desrochers is currently a Postdoctoral Scientist at AstraZeneca. She has...
  5. CRISPR 101: Mammalian Expression Systems and Delivery Methods

    Type
    Blog Post
    ...outcomes can be most effectively achieved with different CRISPR components. Select the appropriate CRISPR...cell lines is quite broad and includes several different methods, so we've summarized some key features...vitro cell culture. The user should review the current literature about their preferred model.  If your...
  6. CRISPR 101: Ribonucleoprotein (RNP) Delivery

    Type
    Blog Post
    ...expression of Cas9/gRNA and can be used for most of the current genome engineering applications of CRISPR including...comes down to the researcher’s familiarity with different systems.  Using Cas9-gRNA RNPs in your experiments...include genome engineering and microbiology.     References 1. Chen, Sean, et al. "Highly efficient mouse...
  7. Plasmids 101: Protein tags

    Type
    Blog Post
    ...Purification Good for antibody-based purification; has inherent enterokinase cleavage site GST Large Protein...protein as pure as possible? Vectors that offer different combinations of tags are readily available, and...information and some protocols can be found in the references provided. Additional resources: Young CL, Britton...
  8. CRISPR 101: Targeting RNA with Cas13a (C2c2)

    Type
    Blog Post
    ...remainder of this blog post. Perhaps the biggest difference between Cas13a and Cas9 is that Cas13a binds ...SHERLOCK (depicted in figure 1) has been used to differentiate strains of Zika virus, genotype human DNA, identify...Gearing contributed to the update of this post. References 1. Abudayyeh, Omar O., et al. "C2c2 is a single-component...
  9. Designing Your Chalk Talk for the Academic Job Interview

    Type
    Blog Post
    ... the Howard Hughes Medical Institute. Are you currently on or planning to go on the academic job market...if your model is correct or your data favor a different model. Finding evidence for or against a model...the answer to your research problem. Creating a coherent unified story and model can help make your ideas...
  10. Lab to Office Culture Shock

    Type
    Blog Post
    ...jarring for the unprepared, and unfortunately, there aren’t a lot of resources out there for scientists making...tight-knit team like that can and will be a little gut-wrenching, but you can get that feeling of camaraderie again...etc.--so everyone’s experience will be a little different. Some of these changes you may enjoy immediately...
  11. Tips for Writing a Good Cover Letter

    Type
    Blog Post
    ...writer? That’s okay! Your cover letter needs to be coherent and free of typos and grammatical errors. It does...skills and experiences fit the job requirements, strengthened an application. Even so, there were examples...experience, having given more than 20 talks at conferences and taught for five years at [name of the university...
  12. Bioinformatics at Addgene

    Type
    Blog Post
    ... has been crucial for us to keep pace with our current need to analyze nearly 300 sequences each week.... address the need to accelerate science using different approaches. We were also encouraged to see that...pipelines for genomic data. Thanks to the flexibility inherent in Nextflow’s design, we were free to use multiple...
  13. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...Gram-negative bacteria become resistant to antibiotics! References Espah Borujeni, Amin, Anirudh S. Channarasappa...engineering in bacteria using homologous recombination." Current protocols in molecular biology 106.1 (2014): 1-...for allelic exchange Read our molecular biology reference Watch molecular biology protocol videos ...
  14. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...vegetable! What is an RNA aptamer? RNA is not inherently fluorescent and can be challenging to track intracellularly...similar properties to Broccoli despite binding to a different small molecule. Notably, like Broccoli, Red Broccoli...reports on the next additions to aptamer soup! References Alam, Khalid K., et al. "A fluorescent split ...
  15. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...to a mouse model of muscular dystrophy. Three different splice site donor and acceptor sequences were ...for a transgene to be reconstituted, there is currently no one ideal split vector system. Overall the ...greater and more consistent transgene expression. References: Allocca M, Doria M, Petrillo M, Colella P, Garcia-Hoyos...
  16. Tips for Getting a Faculty Position

    Type
    Blog Post
    ...no papers, it's unlikely you'll get a job. The currency of scientific success is publications and grants...to convince me that their search committee is different and needs to be told all of the nuances of the...technologies, i.e. video interviews. For point of reference, I submitted my applications all by snail mail...
  17. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ... blog post on Easi-CRISPR for more details. References and resources Want to know more? Check out the...Genome Editing General Homologous Recombination References: Repair of Strand Breaks by Homologous Recombination...Cas-mediated Transgenesis (2018). Pubmed. CRISPR References: Genome engineering using the CRISPR-Cas9 system...
  18. Sequencing Primers

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence... Forward Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC...
  19. Generating Mouse Models Using CRISPR/Cas9

    Type
    Blog Post
    ...therapeutic applications that better human health.     References Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib... Does Not Require Ex Vivo Handling of Embryos. Current Protocols in Human Genetics 88: . https://doi.org...Models Using CRISPR‐Cas9‐Mediated Genome Editing. Current Protocols in Mouse Biology 6:39–66 . https://doi.org...
Showing: 801 - 820 of 1044 results