Addgene

We narrowed to 958 results for: TES

Showing: 901 - 920 of 958 results

Results per page:

Dos & Don'ts When Publishing a Scientific Manuscript

Type

Blog Post

...sure your manuscript fits the house style and prerequisites of the journal. Ask colleagues (preferably native...
Form Your Own Peer Mentoring Group: A How-To Guide for Scientists

Type

Blog Post

...each other practice meeting people – compete for fastest to set up a coffee date or most cards collected...
Will You Be My Mentor? Finding and Asking for Mentoring Support

Type

Blog Post

...Success”. Choose 1-2 tactics to try. One of my favorites is making the pledge to have lunch or coffee with...
Sequencing Primers

Type

Guide

...primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...
Antibodies 101: Fab Fragments

Type

Blog Post

...scenario. References and resources References Bates A, Power CA (2019) David vs. Goliath: The Structure...
Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools

Type

Blog Post

...aberrantly activate the proteasome. Clift et al. tested multiple methods for TRIM-Away delivery. For small...
Transferable Skills Guide: Problem Solving

Type

Blog Post

...come up with several hypotheses on the cause. To test the most likely cause, you implement an experiment...
Developing Lab Management Software for Biology

Type

Blog Post

...academic labs where postdocs, students, and lab mates are coming and going frequently - an environment...
Career Coaching for Scientists: Why and Where Do I Find One?

Type

Blog Post

... email me with suggestions. Most coaches have websites you can review and most create useful online content...
Viral Vectors 101: Calcium Sensors

Type

Blog Post

...engineered with a reduced number of calcium binding sites per sensor (to decrease unnecessary calcium buffering...
Viral Vectors 101: Chemogenetics

Type

Blog Post

...activation is delayed and takes on the order of minutes. Studies looking at immediate effects of specific...
Hot Plasmids May 2018 - Optogenetics, Decaffeination, Biosensors, and Fluorescent Protein Tools

Type

Blog Post

...conversion into xanthine. The majority of this operon originates from Pseudomonas putida CBB5 and has been tailored...
Adeno Associated Virus (AAV) for Cell and Gene Therapy

Type

Blog Post

... Hirsch, M. L., et al. "Self-complementary AAV mediates gene targeting and enhances endonuclease delivery...
Science communication: 9 Strategies to Get Your Foot in the Door

Type

Blog Post

...-scientists in an unusual setting: Discuss your latest research in a local pub at a Pint of Science event...
Hot Plasmids and Viral Preps - January 2021

Type

Blog Post

...well-characterized Cas enzymes, which rely on multiple active sites. In addition, Casɸ has a minimal PAM requirement...
Engaging with science and society at pgEd

Type

Blog Post

... lot of researching and writing – following the latest developments in genetics research, their applications...
CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems

Type

Blog Post

..., 2018). For example, AcrIIA4 mentioned above indicates that it’s the fourth Acr protein discovered that...
Meet an Addgenie: Insights into Grad School, Career Paths, and More

Type

Blog Post

...Associate Scientist at Bristol Myers Squibb and also writes for the Addgene blog. A few of my friends in the...
Fluorescent Proteins 101: Introduction to FRET

Type

Blog Post

...donor-acceptor pair and a change in FRET efficiency correlates with a change in the distance and/or orientation...
Overcoming the Challenges of Lentiviral Production

Type

Blog Post

...third generation packaging systems, this system incorporates the Tet-off transcriptional activation system...

Showing: 901 - 920 of 958 results

Results per page:

Dos & Don'ts When Publishing a Scientific Manuscript

Form Your Own Peer Mentoring Group: A How-To Guide for Scientists

Will You Be My Mentor? Finding and Asking for Mentoring Support

Sequencing Primers

Antibodies 101: Fab Fragments

Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools

Transferable Skills Guide: Problem Solving

Developing Lab Management Software for Biology

Career Coaching for Scientists: Why and Where Do I Find One?

Viral Vectors 101: Calcium Sensors

Viral Vectors 101: Chemogenetics

Hot Plasmids May 2018 - Optogenetics, Decaffeination, Biosensors, and Fluorescent Protein Tools

Adeno Associated Virus (AAV) for Cell and Gene Therapy

Science communication: 9 Strategies to Get Your Foot in the Door

Hot Plasmids and Viral Preps - January 2021

Engaging with science and society at pgEd

CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems

Meet an Addgenie: Insights into Grad School, Career Paths, and More

Fluorescent Proteins 101: Introduction to FRET

Overcoming the Challenges of Lentiviral Production

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections