We narrowed to 1,038 results for: cat

... (2014) A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging....

... tool to identify a protein of interest in a complicated solution like cell lysate. But they can be a ...

...Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.” Genetics. 202(4)...

... from mutations in the gene, and whether any publications have mentioned the gene. The Bloomington Drosophila...

...HDR. Optimal mutation in-depth One the most sophisticated features of CrispyCrunch is how it mutates guide...

...diagonal population, this is a sign of spillover and indicates that it is necessary to apply a compensation value...

...in line 4 of Figure 4. Since the loxP sites are located in intronic regions, this gene will still be expressed...

...desktop. The Plasmids 101 eBook is designed to educate all levels of scientists and plasmid lovers and...

...Agrobacterium tDNA insertion likely precipitated domestication of sweet potatoes (Kyndt et al., 2015)! It sounds...

...other activities. Take care of yourself. Take a vacation alone with your partner – no kids. Get a massage...

...Mbp region of the mouse chromosome. Of the genes located in this stretch of DNA, Ly6a seemed the most likely...

...anticipated outcome, and payoff for each aim. Learn to communicate your story with only the most salient details...

... both accept deposit of data associated with publications into one of five general purpose open source...

...staining. Direct ELISAs also lack the signal amplification afforded by secondary antibodies and thus are...

... written up in mSphere. A post-meeting survey indicated that the program was largely a success, but also...

...many cell types and often results in biallelic modifications. Most commonly, DSBs are repaired by the nonhomologous...

...created by making some or all of the following modifications: 1) increased concentration of Taq polymerase...

...interested in using CRISPR to develop therapeutic applications that better human health.     References Cong...

...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato... Reverse WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...

...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...need to use the reverse complement to get PCR amplification. We can start similarly, taking the final 18bases...