Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 1,035 results for: cat

Showing: 961 - 980 of 1035 results

  2. Antibodies 101: Flow Compensation

    Type
    Blog Post
    ...diagonal population, this is a sign of spillover and indicates that it is necessary to apply a compensation value...

  16. Sequencing Primers

    Type
    Guide
    ...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato... Reverse WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...

  17. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...need to use the reverse complement to get PCR amplification. We can start similarly, taking the final 18bases...

  18. Using a Light Microscope Protocol

    Type
    Protocol
    ...10x magnification. To determine the final magnification of your image, multiply the magnification of your...most important properties of a microscope are magnification (the ability to make an image larger) and resolution...reaches your eyes. These lenses determine the magnification of the image and the resolution your microscope...information, but the most important (for now) is the magnification power, such as 4x, 10x, or 20x. A 4x objective...times, and so on. The ocular lens also provides magnification and the power should be provided on the microscope... your objective lens by the magnification of your ocular lens. For example, if you observe something using...positioning and focus of your image on the lowest magnification, you are ready to move up to the next objective...

  19. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ... all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent...terminal repeat. f1 ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection...bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... C.1 Recommended Materials Material Vendor and catalog # AgeI New England Biolabs (NEB) #R0552S EcoRI ... D.1 Recommended Materials Material Vendor and catalog # DNA Miniprep Kit Qiagen #27104 EcoRI NEB #R0101S...

  20. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Name Description (Link opens in a...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...Cloning by PCR Generate restriction sites by PCR Modification by Annealed Oligo Cloning Add a short stretch...your gene of to the target of your choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify...preparation Antibodies Protocols for common antibody applications. Name Description Link to Video Transfection...
Showing: 961 - 980 of 1035 results