We narrowed to 1,031 results for: cat
-
TypeBlog Post...diagonal population, this is a sign of spillover and indicates that it is necessary to apply a compensation value...
-
Plasmids 101: Multicistronic Vectors
TypeBlog Post...desktop. The Plasmids 101 eBook is designed to educate all levels of scientists and plasmid lovers and... -
Tips for arabidopsis transformation
TypeBlog Post...Agrobacterium tDNA insertion likely precipitated domestication of sweet potatoes (Kyndt et al., 2015)! It sounds... -
Negotiating Work and Life: How to Find the Joy
TypeBlog Post...other activities. Take care of yourself. Take a vacation alone with your partner – no kids. Get a massage... -
Binning Singletons: Tackling Conference Networking When You Don’t Know Anyone
TypeBlog Post... written up in mSphere. A post-meeting survey indicated that the program was largely a success, but also... -
Beyond the Blood Brain Barrier: PHP.B Enters the Central Nervous System Via the LY6A Receptor
TypeBlog Post...Mbp region of the mouse chromosome. Of the genes located in this stretch of DNA, Ly6a seemed the most likely... -
Designing Your Chalk Talk for the Academic Job Interview
TypeBlog Post...anticipated outcome, and payoff for each aim. Learn to communicate your story with only the most salient details... -
Supporting Reproducibility with a Connected ELN
TypeBlog Post... both accept deposit of data associated with publications into one of five general purpose open source... -
Antibodies 101: The Four ELISAs and When to Use Them
TypeBlog Post...staining. Direct ELISAs also lack the signal amplification afforded by secondary antibodies and thus are... -
3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells
TypeBlog Post...many cell types and often results in biallelic modifications. Most commonly, DSBs are repaired by the nonhomologous... -
Deep Mutational Scanning with One Pot Saturation Mutagenesis
TypeBlog Post...created by making some or all of the following modifications: 1) increased concentration of Taq polymerase... -
Generating Mouse Models Using CRISPR/Cas9
TypeBlog Post...interested in using CRISPR to develop therapeutic applications that better human health. References Cong... -
Sequencing Primers
TypeGuide... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...used a number of primers for sanger sequence verification of deposited plasmids. Below is a list of commonly... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...Vector by Gel Purification Run your digest DNA on an agarose gel and conduct a gel purification to isolate...not cut within your insert. Are in the desired location in your recipient plasmid (usually in the Multiple...amplify and design primers that will bind to and replicate it. The following image shows the ends of the ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...need to use the reverse complement to get PCR amplification. We can start similarly, taking the final 18bases... -
Using a Light Microscope Protocol
TypeProtocol...10x magnification. To determine the final magnification of your image, multiply the magnification of your...most important properties of a microscope are magnification (the ability to make an image larger) and resolution...reaches your eyes. These lenses determine the magnification of the image and the resolution your microscope...information, but the most important (for now) is the magnification power, such as 4x, 10x, or 20x. A 4x objective...times, and so on. The ocular lens also provides magnification and the power should be provided on the microscope... your objective lens by the magnification of your ocular lens. For example, if you observe something using...positioning and focus of your image on the lowest magnification, you are ready to move up to the next objective... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol... all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent...terminal repeat. f1 ori f1 bacterial origin of replication. Amp R Ampicillin resistance gene for selection...bacterial cells pUC ori pUC bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... C.1 Recommended Materials Material Vendor and catalog # AgeI New England Biolabs (NEB) #R0552S EcoRI ... D.1 Recommended Materials Material Vendor and catalog # DNA Miniprep Kit Qiagen #27104 EcoRI NEB #R0101S... -
Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps
TypeProtocol...Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification Measure...protocols that you can use for a wide range of applications, with videos for select protocols in the right-hand...protocols are the building blocks for many more complicated procedures. Name Description (Link opens in a...bacterial strain Watch the Video! CRISPR Library Amplification Amplify CRISPR pooled-plasmid libraries Diagnostic...Cloning by PCR Generate restriction sites by PCR Modification by Annealed Oligo Cloning Add a short stretch...your gene of to the target of your choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify...preparation Antibodies Protocols for common antibody applications. Name Description Link to Video Transfection... -
Plasmid Cloning by Restriction Enzyme Digest (with Protocols)
TypeProtocol...vector by gel purification Run your digested DNA on an agarose gel and conduct a gel purification to isolate... not cut within your insert Are in the desired location in your recipient plasmid (usually in the Multiple...plasmids. Because you lose some DNA during the gel purification step, it is important to digest plenty of starting...prior to the ligation step or prior to the gel purification step, depending on the phosphatase you choose...isolate the DNA. When running a gel for purification purposes it is important to have nice crisp bands and...bands away from the gel via your favorite gel purification method, it is important to determine the concentration...from your transformation will give you the first indication as to whether your transformation worked. our... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...Load 5 μL of each standard in duplicate Load 5 μL of each sample in duplicate. Do not forget to include a...dilution is appropriate). Quality of duplicates: Exclude duplicates from analyses if there is more than...Considerations Always run standards and samples in duplicate at least If possible, include an AAV reference...standard with DNase ** Make 6 serial dilutions, in duplicate, of your standard curve plasmid (2 x 10 9 stock...second peak at a temperature of ~70–75 °C usually indicates the presence of primer dimers which can increase...point standard curve. Figure 2: Example of the amplification plots obtained from an AAV sample. Each curve...Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived... -
Kit Free RNA Extraction
TypeProtocol...You may also like... Kit-Free DNA Purification Agarose Gel Purification Molecular Biology Reference Introduction...information on nucleic acid quantification, see our protocol for DNA quantification , which can be modified... not affect the quality of RNA or downstream applications. To improve yield of RNA, instead of incubating...