We narrowed to 520 results for: HA tag
-
TypeBlog Post... have the option to indicate separate promoters, tags, or cloning information for each insert. Encodes...insert into it. Empty backbones often contain epitope tags or fusion proteins that are appended to new inserts... indicate the gene cloned into your plasmid, any tags or fusion proteins contained in the plasmid, any...biosensor affinity for calcium". Please describe any tags or fusions (e.g. His, FLAG, EGFP, etc) on your insert.... Use the drop-down menu to indicate whether the tag is on the N or C terminus and whether it was present...as they pass our standard QC process and the MTA has been approved. The spreadsheet option is recommended...cloned into the vector backbone). If your plasmid has more than one insert, click "Save and Add Another...
-
CRISPR 101: Ribonucleoprotein (RNP) Delivery
TypeBlog Post...such as visualizing genomic loci using fluorophore tagged dCas9 may require the use of plasmid or viral-mediated...alternative approach is to express and purify His-tagged Cas9 from E. coli using a plasmid such as pET-28b-Cas9...can be used to deliver a Cas9-gRNA RNP. This advantage has allowed scientists to perform in vitro and in...figure above), are in the early stages of development. David Liu’s Lab has demonstrated the use of cationic...CRISPR has greatly enhanced the ability of scientists to make genomic alterations, bringing about a revolution...inserting a custom gRNA. While this methodology has proven to be incredibly valuable to scientists, there...to the use of this technique in cell culture, it has also been applied to genome editing of mouse zygotes... -
Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene
TypeBlog Post...plasmid. Confirming tags and fusion proteins Finally, we confirm promoters, tags, fusion proteins, and...anyone who has ever worked to sequence DNA on NGS platforms will tell you, while the process has become much...aligning to NCBI entry or using BLAST. Confirming tags and fusion proteins. We’ll break down each of these... -
Caltech Systemic Capsids
TypeCollection...used in LY6A-nonpermissive mouse strains. **AAV1-X1 has not been tested in rats. Abbreviations: AAV, adeno-associated...Enhanced CNS tropism exhibited by the PHP.eB serotype has been reported to occur by using the cellular receptor... CN1390-rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-... -
Plasmids 101: Knockout/Knock-In Plasmids
TypeBlog Post...make it possible to insert, or knock-in, any gene, tag, or mutated exon into the genome. For this purpose...promoter responds. You can also use this method to tag an endogenous protein with GFP, as seen in blue flame...avoid selecting for cells in which the construct has randomly integrated into the genome, a negative selection... opposed to screen for cells where recombination has occurred. Neomycin, puromycin, and hygromycin resistance...still functions normally because one of its exons has simply been replaced with the same sequence flanked...flanked by LoxP sites while the resistance cassette has been placed into an intron. Figure 4: ...second the floxed exon. After recombination has occurred, you'll first remove the resistance marker... -
Tips for Using BLAST to Verify Plasmids
TypeBlog Post...to an epitope tag or fusion protein. If your sequencing primer was chosen to confirm a tag or fusion protein... in NCBI’s numerous databases. As our repository has grown over the years (we now have over 60,000 plasmids...we analyze as part of our quality control process has steadily grown. On a busy week, we may need to analyze...our quality control process. Consequently our team has refined our use of the BLAST web browser interface...also enjoy seeing how our quality control process has changed with the introduction of next generation ...BLAST (blastp), and Translated BLAST (blastx). NCBI has a terrific getting-started guide for BLAST, which...expected ORFs, mutations or truncations. A primary advantage of blastx is that you do not have to decide on... -
The Fluorescent Vegetables in Aptamer Soup
TypeBlog Post...transforming cells with plasmids encoding aptamer-tagged RNA and later introducing the small molecule into...measurement of processes including RNA movement by tagging RNA sequences with an aptamer and RNA transcription...purification of specific RNAs from cells using this tag, and both TO1-biotin and TO3-biotin contain an acetate... improve its stability in vivo. However, Spinach has proven useful in the engineering of riboswitches....syndrome (Strack et al., 2013). Since then, Spinach2 has been used to investigate intracellular viral DNA ...better choice for imaging than the monomer. Broccoli has been developed into a split aptamer that can be used...s group created Spinach2 using site-directed mutagenesis of Spinach. In doing so, they identified the ... -
Molecular Biology Reference
TypeGuide...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence... -
Sequencing Primers
TypeGuide...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end... -
CRISPR 101: Mammalian Expression Systems and Delivery Methods
TypeBlog Post...to see if anyone has published a protocol that would work for your system. Addgene has depositor submitted...knockouts or knock-ins, or introducing mutations and tags, while a catalytically dead dCas9 can be used in...to create knock-ins, point mutations, or to add a tag, you will also need to deliver a donor plasmid or...Sep 30, 2020 by Marcy Patrick. CRISPR technology has been widely adopted for genome editing purposes because...Mammalian CRISPR expression systems Each model system has its own best practices for efficient delivery of ... -
Plan Your Experiment
TypeCollection...such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual...large percentage of DSBs are still repaired by NHEJ. How do you determine that your desired edit has occurred...Cas9-gRNA ribonucleoprotein (RNP) complexes are advantageous due to the transient Cas9 expression. The table...: Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed... -
15 Hot Plasmids from 2017
TypeBlog Post...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation mutants...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...inhibitory GABA-ergic interneurons, Gordon Fishell’s lab has developed a new AAV approach using regulatory elements...fluorescent protein - mScarlet! The Dorus Gadella lab has recently developed a synthetic red fluorescent protein... imaging and in protein fusions. The Gadella lab has deposited all mScarlet constructs with Addgene. ... -
CRISPRainbow and Genome Visualization
TypeBlog Post... vivo. Some researchers have used fluorescently tagged DNA-binding proteins to label certain loci, but...Kits Find Empty Backbones with Fluorescent Protein Tags ...called the 4D nucleome. Visualizing specific loci has historically been difficult, as techniques like fluorescent...visualize genomic loci in vivo The flexibility of CRISPR has improved our ability to target almost every genomic... system and induce genome editing. Such a system has been previously described for transcriptional activation... -
Scientists Map the SARS-CoV-2-Human Interaction Network
TypeBlog Post... straight-forward. All constructs are tagged with a 2xStrep-tag for easy detection and affinity purification...time Since the publication of our paper, our group has been inundated with requests to share our plasmids...). Also, we’ve got to mention that our FedEx guy has been the best: Thanks, Todd! As you can imagine, ...follow us on Twitter (QBI_UCSF and KroganLab), Instagram, and Facebook. Find more COVID-19 and coronavirus... -
Cre-lox system
TypeCollection...hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR Cre, KASH-tagged EGFP, and sgRNA expression hSyn AAV Zhang 60820...fluorescent labels that indicate if recombination has occurred, allowing for direct comparison of Cre+ ...optimize Cre expression once it is induced. Addgene has a wide variety of Cre recombinase plasmids. Special...rates of Cre-driven recombination. CREM (or Cre-M) has been engineered to contain an intron, preventing ...73472 RabV CVS-N2c(deltaG)-mCherry-P2A-Cre Cre CMV RABV Jessell 73474 RabV CVS-N2c(deltaG)-Cre Cre CMV RABV...Simpson 106368 pCMV-Tag2B-NCre N-terminal split-Cre CMV Mammalian Hirrlinger 106369 pCMV-Tag3B-CCre C-terminal...106370 pCMV-Tag2B-NCreERT2 N-terminal split-Cre-ERT2 CMV Mammalian Hirrlinger 106371 pCMV-Tag3B-ERT2CCre ... -
Plasmids 101: Modular Cloning Applications and Kits
TypeBlog Post...purification tags, connectors, cDNAs, and more to find the perfect combination. The EcoFlex Kit has a wide ...constitutive and inducible promoters, linkers, and tags makes EcoFlex a great option for those interested... a larger library of parts but don’t need to add tags to your proteins, then the CIDAR Kit is an excellent...yeast MoClo is also for eukaryotes! The technology has been used to optimize protein secretion and expression...possible through MoClo. The MoClo Plant Parts Kit has everything you would expect in a MoClo kit plus the... general plant cloning experiments. Addgene also has two additional MoClo plant kits: Plant Parts Kit ...; Chamness et al., 2023). The Plant Parts II kit has a focus on infrastructure with shuttle vectors, several... -
The 10 Most Distributed Plasmid Technologies in Addgene's First 10 Years
TypeBlog Post... requested ubiquitin plasmids were pRK5-HA-Ubiquitin-WT and HA-Ubiquitin, and we now have 19 different... years. Biosensors - Plasmids for fluorescent tagging have long been popular with scientists, but 2012...founded 10 years ago today. In that time, Addgene has shipped over 350,000 individual plasmids to 5,000...5,000 different research institutions. This has given us a unique window into technology trends in the life...the CRISPR." The newest genome editing technology has been used and modified by so many labs and for so... -
The Blue Flame Award: Celebrating Addgene's Most Requested Depositors
TypeBlog Post...indicates that a plasmid has been requested 20+ times A red flame means a plasmid has been requested 50+ ...love to see you show it off! To share your photo, tag @Addgene and #happydepositor on Twitter. All Blue... Castro of University of Michigan says, “Addgene has transformed the way in which we share plasmids and...making it easier, cost effective and faster; this has helped accelerate scientific discoveries.” Occasionally...+ times A blue flame means a plasmid has been requested 100+ times Since we so sincerely appreciate ...have at least one plasmid deposited at Addgene that has been distributed more than 100 times. We hope these...sharing because, as UNC’s Bryan Roth says, Addgene has “literally enabled sharing with 100's of investigators... -
Hot Plasmids - November 2023
TypeBlog Post...lentiviral vectors to stably or inducibly express tagged iPAK4 from different promoters, specific time points...plasmids here! Lin D., Li X., et al. (2023). Time-tagged ticker tapes for intracellular recordings. Nature...off-target effects of gene therapy, Feng Zhang’s lab has developed a system called DIRECTED (Delivery to Intended...on-target delivery with various delivery modalities and has the potential to reduce negative side effects. This... assays like IHC. In fact, Anti-PSD-95 [K28/43R] has been one of the hottest antibodies in Addgene’s collection... collection since we began distribution and has been verified to perform well in standard IHC and western...externally-timed bands of color with HaloTag-iPAK4 by applying different HaloTag dyes and showed they could record... -
When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells
TypeBlog Post... fusion tag to be inert, to not produce artifacts in your experiments. Considerable effort has gone into...solution or something in between, you are using a tag with a serious drawback. The standard EGFP plasmid...world, is not inert. In all seriousness, EGFP/GFP has a real nontrivial propensity to noncovalently dimerize...dimerizing protein of interest fused to a dimerizing FP has potential to form large stable polymers of dimers... monomerized with an A206K mutation [2]. Addgene has many of these constructs and they are designated ...oligomers such as DsRed or high affinity FPs such as TagRFP. Problem 3 can be solved, in most cases, by using...