Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 567 results for: PAC;

Showing: 121 - 140 of 567 results

  1. CRISPR 101: Targeting RNA with Cas13a (C2c2)

    Type
    Blog Post
    ...commonly associated with CRISPR arrays and involved in spacer acquisition following infection, as a form of “...is reduced when 2 mismatches are present. The protospacer flanking sequence (PFS) for LshCas13a, which ...sequence for Cas9, is located at the 3’ end of the spacer sequence and consists of a single A, U, or C base...each DNA target have high sequence identity to the spacer sequence and contain the appropriate PAM sequence...cells. LwaCas13a-msfGFP can mediate cleavage with spacers from 20-28 nucleotides in length and does not require...

  2. Avoiding the Dark Side of Fluorescent Protein Fusions with mOX FPs

    Type
    Blog Post
    ...investigators realize too late that they have missed the impact of dark, non-fluorescent, and misfolded FP-fusions...quantitative imaging experiments or even negatively impact cells (see Figure 1). When behaving properly, ... the function of resident ER chaperones and may impact cellular function or possibly viability. FP misfolding.... It remains unclear whether the FP misfolding impacts fusion protein function and this could lead to ...secretory pathway (Figure 2), the inner membrane space of mitochondria and chloroplasts, the extracellular...

  3. March for Science

    Type
    Blog Post
    ...aspects of research at National Aeronautics and Space Agency, the Environmental Protection Agency, and...long-term science outreach, may have the most profound impact (15). Diversity and inclusion in science, technology... immigrants, and minorities who have had great impacts on STEM (21–26). Increased scientific funding...communities (something already encouraged by “Broader Impacts” requirements for certain grants) (28). As one ...Science Foundation 15-008: Perspectives on Broader Impacts. The Pipettepen: The March for Science Raises Concerns...

  4. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer (34 bp) lox2272, lox5171, lox511, loxN, lox66/lox71...TAACTTTAAATAATgccaATTATTTAAAGTTA 14 bp inverted repeats + 4 bp spacer (32 bp) Currently, only the canonical rox site ...GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8 bp spacer (48 bp or 34 bp) F3, F5, FRT14, FRT15 minimal FRT...feature Cre-dependent tools, or consider our AAV Packaged on Request service for more options. Addgene blog...feature Flp-dependent tools, or consider our AAV Packaged on Request service for more options. Addgene blog...

  5. Scientific Reproducibility - Focusing on Solutions at the Minisymposium on Reproducibility

    Type
    Blog Post
    ... over-reliance on the perfect story for a “high impact” publication can lead to the publication of rare...experiments on similar subjects in a single, searchable space. Finally there are new publishing outlets like F1000... data even if it isn’t considered immediately impactful. Down the line we may see further adoption of ...criticisms that focus less on perceived novelty and impact. Journals could also begin requiring reproducibility...health of the scientific enterprise and not just impact. Cause #3: Poor experimental design It’s easy to...

  6. Validated gRNA Sequences

    Type
    Collection
    ...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....

  7. Optogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics ...Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus Constitutive 1, 9... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  8. Caltech Systemic Capsids

    Type
    Collection
    ... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service: Caltech...CAP-B22 AAV9-X1.1 As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use...window) Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  9. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...

  10. Reflections and Looking Ahead

    Type
    Blog Post
    ...these milestones remind us of the extraordinary impact that happens when scientists come together to share...more AAV viral vector options, we launched AAV Packaged on Request, a service that dramatically expands... transfer plasmid in our repository can now be packaged on demand in five distinct serotypes, offering...breakthrough enabled brings us closer to making an impact on humanity's greatest challenges. Thank you for...

  11. Serotype Testing AAV

    Type
    Collection
    ... Viral Vector Packaging Service AAV Serotype Testing AAV Viral Vector Packaging Service: Serotype ...order it? Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  12. Recombinases AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Recombinases Viral Vector Packaging Service: Recombinases ... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  14. AAV for Neuronal Tracing

    Type
    Collection
    ... Viral Vector Packaging Service AAV Monosynaptic Neuronal Tracing Viral Vector Packaging Service: Tools...17329205 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  15. Viral Vectors 101: Transductions

    Type
    Blog Post
    ...viral packaging elements that will ensure the virus gets produced, and viral particles are packaged, when...is then typically transfected along with viral packaging plasmids into a viral production cell line, usually...cell line, viral particles will be produced and packaged, resulting in functional virions. These viral ...

  16. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...dendrites on neighboring neurons. We have also packaged hChR2(H134R) plasmids from Karl Deisseroth’s lab... Janelia, including three jGCaMP7 plasmids now packaged in AAVrg. jGCaMP7s, the variant with the most ...variant with higher affinity to glutamate, has been packaged into AAVrg. Plasmid Serotype Name 106174 ...Viral vectors coming soon! These vectors should be packaged and available as AAV in the next few months. Email...

  17. Extracurricular Activities for a Strong Science Career Path

    Type
    Blog Post
    ...professorship. But recently a downward trend in funding and space in academic research labs has more students looking...are crucial in demonstrating the true innovation, impact and, in turn, the big picture of the project. For... For example, how can future regulations impact your work? What design variables need consideration? Enrich...project is an innovative solution with a strong impact, or a journalist does not understand the high-level...

  18. Chemogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics...Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  19. AAV Molecular Tools

    Type
    Collection
    ... Viral Vector Packaging Service AAV Molecular Tools Viral Vector Packaging Service: Molecular Tools...1 Ikezu Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  20. Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

    Type
    Blog Post
    ...of the individual’s work in their field and the impact of the individual’s past work on the field. NIW...experts in the field. You must also be able show the impact of your influence on your field of employment. ...contributions to the field that have had a major impact. For example, you were the first person to identify...that you are given to present your expertise and impact on your field from the point of view of experts...current research goal is and why your work has impacted your field (i.e. finding vaccines for deadly disease...
Showing: 121 - 140 of 567 results