We narrowed to 383 results for: Lor
-
TypeBlog Post....”- Joanne Kamens, Executive Director Career exploration “You can't wait for opportunities to fall in .... But there were a few teachers and 'guidance counselors' along the way who thought it was risky, "not...
-
Addgene's Top Blog Posts from 2020
TypeBlog Post...methods in this blog post. 8. Chromoproteins: Colorful Proteins For Molecular Biology Experiments by ...the fluorescent protein family and they generate color! They've been adapted for many molecular biology... -
Validated gRNA Sequences
TypeCollection...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462... -
Science as Art
TypeBlog Post... who passed away in 2008. His work exposes and explores the hidden structures within flowers with the ...technique provides scientist with a new method to explore the inner structures of delicate plants and other... -
CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]
TypeBlog Post...]. With the advent of CRISPR/Cas9, we began to explore the paired double-strand break (DSB) approach at...ectopic reporter assays. We have been interested in exploring the function of non-coding regulatory elements... -
Tag Your Favorite Yeast Genes with Ease
TypeBlog Post...fluorophore tagging vectors for your single or multi-color imaging experiments. Interested in epitope tags?... Julian Taylor-Parker... -
Same Addgene, New Look - Why We Redesigned Our Homepage & Mascot
TypeBlog Post...highlight our blog, daily updates, and offer better exploration throughout the site. Blugene gets a make-over...AAV friend. We encourage you to take a look and explore the new homepage. We hope every time you come to... -
Working 9-5: an Addgene Co-op
TypeBlog Post...responsibilities on the QC team, I was able to explore other parts of Addgene. This was done through the.... Specifically as a co-op, it is encouraged to explore different teams and work on projects there. At ... -
Oh, The Places You Can Go: Careers in Science Communication - Product Development
TypeBlog Post...science. “It ended up we moved to Colorado for my husband’s postdoc. Colorado is growing in the biotech sphere... -
Early Career Researcher Toolbox: Free Tools for Making Scientific Graphics
TypeBlog Post...and drag and drop an icon onto the workspace. The color and size of icons are adjustable. New icons can ...scientific graphics. The tools settings let you tailor your search to particular types of images. For ... -
CASTing Off for New Shores in Human Genome Editing
TypeBlog Post...capacity of transposons open whole new worlds to explore. The newest arrival on the scene is called evoCAST... In the emerging world of gene therapy, highly tailored treatments to specific mutations require individualized... -
Five Questions to Ask If You're Deciding Between a Master's or PhD Program
TypeBlog Post...opportunities for promotion. It’s not uncommon for bachelor’s and master’s level scientists to have job titles...Now? Academic v. Non-Academic Career Decisions Explore alternative science career options Resources on... -
Behind-the-scenes of the Isolation of the Thermostable IgnaviCas9 From a Yellowstone Hot Spring
TypeBlog Post...Lab at Stanford University became interested in exploring biological dark matter – large tracts of the microbial... microbial tree of life that remained unexplored. Using new single-cell sequencing approaches, the lab... -
5 Uncommon Ways to Gain Career Skills During an Uncommon Time
TypeBlog Post...more details on how to make the most of these exploratory conversations. If you set yourself a goal of ...to Find Funding For Your Research University of Florida: Training Grants and Other Funding Opportunities... -
RUBY-Red Siliques
TypeBlog Post... plants (from callus) or T1 plants (Arabidopsis floral dip). In the next generation the CRISPR construct...right) A RUBY-expressing Arabidopsis seed following floral dip transformation next to an untransformed seed... -
Science Career Options
TypeBlog Post...actually want, you can feel lost. Use this post to explore the wide range of careers available to scientists...roles. These types of skills show that you fully explore the different options available and then decide... -
Learning Technical Skills at a Lab Central Workshop
TypeBlog Post...companies. The space was modern with clean bold colors of orange and white. The decor was very contemporary...Addgene lab, we don’t often get the opportunity to explore new techniques in our own space. Workshops such... -
Addgene-Seeding Labs plasmid grant round 3: microbial drug resistance and biofilms, antidiabetic plant components, visualizing brain injury - and a glowing robot fish
TypeBlog Post...plant compounds to treat complications of diabetes Gloria Otito Izu, PhD Candidate, University of Ibadan,...Oluwatosin Adeyi, University of Ibadan, Nigeria Gloria Otito Izu is a PhD Candidate working under the ... -
Creating accessible biology activities in schools with BioBits
TypeBlog Post...school could afford – led me to develop BioBits ExplorerTM and BioBits BrightTM, biology kits based on freeze-dried... References 1. Huang, Ally, et al. "BioBits™ Explorer: A modular synthetic biology education kit." Science... -
FPbase: A new community-editable fluorescent protein database
TypeBlog Post...entities with a large range of characteristics (color, brightness, photostability, maturation, oligomerization...Protein Choosing Your Fluorescent Proteins for Multicolor Imaging Resources on Addgene.org Browse all...