Skip to main content

We narrowed to 257 results for: gfp gene

Showing: 141 - 160 of 257 results
  1. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...include: EGFP-expressing AAV for serotype testing Calcium sensors and GABA sensors Optogenetics Recombinases... pAAV.hSynap.iGABASnFR (112159-AAV1) Optogenetics Optogenetics continues to be a useful method for manipulating...viral vectors 101 eBook Resources on Addgene.org Learn about Addgene's viral service Find viral protocols... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...recently released these controls: pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad...broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE (51502-AAV5): The CAG promoter directs ubiquitous expression...
  2. Lentivirus Plasmids

    Type
    Collection
    ...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...and regulatory genes; one plasmid in second-generation, two plasmids in third-generation Envelope plasmid...contains packaging gene env This collection highlights popular second- and third-generation lentiviral packaging...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...promoter for transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP reporter....24129 pULTRA 3rd Bicistronic expression of EGFP and the gene of interest. Can also express shRNA (cloning...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin...
  3. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...sequence between two target sites. Modifying multiple genes at once. Using multiplexed gRNAs can target multiple...simultaneous multiplex editing of six different genes. This system doesn’t rely on any additional or host-dependent...from this paper at Addgene. 9. Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic ...plasmids from this paper at Addgene. Additional Resources on the Addgene Blog Browse Our CRISPR Topic...add multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use...multiplex gRNAs, some being: Using dual nickases to generate a knockout or edit. This can help reduce off-target...
  4. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, or both...Karl Deisseroth (Addgene viral prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from... plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral helper sequences...viral vectors are tested in vitro and in vivo for gene expression and/or function. These data are sometimes...copies of the lentiviral Rev responsive element (RRE) gene and the cellular ribonuclease P/MRP 30 kDa subunit...Production AAV distributed by Addgene has been produced either in-house by Addgene scientists or through collaboration...
  5. Synthetic Photobiology: Optogenetics for E. coli

    Type
    Blog Post
    ...plasmids from this publication at Addgene. Multichromatic control of gene expression in Escherichia coli...optimized by Tabor’s lab, making light-controlled gene expression in E. coli easier and more robust. Synthetic...used to engineer new pathways with sophisticated gene expression controls. Most cell types do not respond... can be coexpressed for sophisticated control of gene expression. An E. coli light-sensitive two-component...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly... was only about 10-fold, precluding the study of gene expression at very high or very low levels. Schmidl...researchers to better fine-tune the level of output gene expression based on the input light intensity. In...
  6. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...test for your gene of interest may be another method to assess transfection success. GFP is often used...lines and are not used for general plasmid selection. Instead, reporter genes are often employed to easily...conjunction with positive selection to ensure your gene gets targeted to a specific location within the ...used selection markers are listed below: Name Gene Conferring Resistance Cell Types* Mode of Action...use G418. This can be confusing since the neo/kan gene confers G418 resistance; however, like gentamicin...Read More: Plasmids 101: Antibiotic Resistance Genes Plasmids 101: Origin of Replication All Plasmids...the genetic traits of the foreign material and will subsequently pass it on to future generations. Stably...
  7. Multiplexed Overexpression of Regulatory Factors (MORF) collection

    Type
    Blog Post
    ... for gene expression, turning transcription on and off by binding proximal to their target genes. Since...Since gene expression patterns determine everything from stem cell differentiation fate to tumor suppression...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order...from the library to further investigate specific genes and TF isoforms. Due to the size of the collection...use to generate the relevant disease model. Accurate modeling of a disease depends on both genetic and expression... not yet available, just ask an Addgene scientist at help@addgene.org! References and Resources  References...scientific community. Recently, the Zhang lab generated a TF library (aka the MORF Collection) and an ...
  8. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ... also includes a GFP construct as a control. For easier portability, all viral genes are flanked by EcoRI...coronavirus or COVID-19 research, please email Addgene at help@addgene.org with your order number and so it can .... Sign up for email alerts on the Krogan lab's Addgene page to get notified!) Attacking coronavirus, one...reasons, the QCRG is delighted to be partnering with Addgene, who will be taking over the distribution to expand... coronavirus related plasmids and resources at Addgene* Many thanks to our guest bloggers Manon Eckhardt...
  9. Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System

    Type
    Blog Post
    ...that control cell cycle gene expression.  Additional Resources on the Addgene Blog Visit the fluorescent...page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org Find fluorescent protein...work in Lin Tian’s lab at UC Davis is to generate a genetically encoded fluorescent sensor for serotonin...sequence an individual’s genome. But when they find genetic variants, what does that mean? Previous research...of Washington sought to address the effects of genetic variants in a high throughput manner. She helped...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...
  10. Hot Plasmids - June 2019 - Optogenetics, Acoustic Reporter Genes, microRNAs, and the CRISPR-Cas9 system CHIME

    Type
    Blog Post
    ...developed four acoustic reporter gene (ARG) plasmids to better monitor gene expression in vivo using ultrasound...non-immunogenic violet-excited GFP variant Vex. To understand the impact of this gene editing tool on the immune...plasmids at Addgene. Liu Q et al., Neuron. 2019. PubMed PMID: 30704911. Acoustic reporter genes for noninvasive...by Lukas Morgan  Listen to the acoustic reporter gene podcast segment In recent years, scientists are ...through a host organism, the expression of some genes can change depending on the location. Current methods...of microbes rely heavily on fluorescent protein genes. These optical reporters have limited deep-tissue...ultrasound. These ARG plasmids contain genes for “gas vesicles,” a gas-filled protein structure that water-bound...
  11. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...
  12. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type
    Blog Post
    ...They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any additional tips,...homology arm as a gBlocks® Gene Fragment from Integrated DNA technologies. Generally speaking, anyone using... an effort to track down every last one of those gene regulatory proteins and the places in the genome...together on several projects and this is one related to gene expression. One goal of the ENCODE project is to...with detailed protocols, go to www.addgene.org/crispr/tagging. Addgene: What motivated you to adapt CRISPR...tagging system, which they’ve now made available at Addgene. For more details on the plasmids that are currently...can now look at many more transcription factors. Addgene: How does the system work? Mendenhall: The system...
  13. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...Utilization During Gene Targeting with Zinc-Finger Nucleases. G3 Genes Genomes Genetics, 3(4), 657–664. ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...Jaenisch, R. (2013). One-Step generation of mice carrying mutations in multiple genes by CRISPR/CAS-Mediated ...example, choosing target sites that span the knock-in gene. For making mutations, one good way is to mutate...be okay if you are introducing a selection marker gene. The homology arms should be no more than 100 bp...for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper ...Winderbaum, J., Nickoloff, J. A., & Jasin, M. (1998). Gene Conversion Tracts from Double-Strand Break Repair...
  14. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ...into contact with than GFP. Similarly, if the viral vector carries an shRNA to a gene essential for cellular...looks like the genetic cargo in one plasmid (the transfer plasmid), the envelope (Env) gene on a separate...with those particles. Since the Env, Gag, and Pol genes are not encoded in the transfer plasmid, the component...Resources Resources on Addgene.org Addgene viral services Addgene Biosafety Guide Addgene Viral Plasmids ...? That’s okay! In this article we will discuss general viral safety considerations and best practices ...of what is being integrated by the virus. If an oncogene overexpression construct is being delivered, that... and the same holds true for types of viruses generated in the lab. The four most common types of viruses...
  15. Serotype Testing AAV

    Type
    Collection
    ...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...
  16. Viral Vectors 101: Calcium Sensors

    Type
    Blog Post
    ...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free...Resources on Addgene.org Addgene’s AAV Guide Fluorescent Proteins: Biosensors Addgene’s Viral Services...calcium sensors. Selecting a calcium sensor Genetically encoded calcium indicators (GECIs) are fluorescent...neuronal cell body or the axon (GCaMP6 only). The genetic elements required for Drosophila studies have been...chemical biology. 2021 May;17(5):509-18. Inoue M. Genetically encoded calcium indicators to probe complex brain...Aug 1;169:2-8. Suzuki J, Kanemaru K, Iino M. Genetically encoded fluorescent indicators for organellar...SA, Looger LL. Imaging neuronal activity with genetically encoded calcium indicators. Cold Spring Harbor...
  17. Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards

    Type
    Blog Post
    ...line, Hep3B. From left to right: Mitotracker Red, GFP for the biosensor, Hoechst, and overlay).   ...(DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based biosensors for live cells. His work focuses..., Pedre Pérez’s biosensor fuses MPST to roGFP2. Because roGFP2 contains two cysteines near the chromophore...developed a dual virus system using both optogenetics and chemogenetics to study the activity of parvalbumin...in the lab. He has recently developed a third-generation intensiometric glutamate sensing fluorescent ...catalyzes the desulfuration of 3-mercaptopyruvate and generates an enzyme-bound hydropersulfide that is then transferred...the MPST hydrosulfide can be transferred to the roGFP2 cysteine thiols and change its fluorescence properties...
  18. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ...Cre-lox Control Protein Activity with GFP Resources at Addgene.org Find KTR reporter plasmids Find photoactivatable...spatiotemporal resolution than pharmacological or genetic approaches, but only a few such methods exist and...Solution: In Zhou et al, the Lin lab present a generic design for creating photoswitchable kinases and...possible to create other photoswitchable kinases? The general design of psMEK1 also worked for creating three...PMCID: PMC4097317. Additional Resources on the Addgene Blog Learn More about Photoactivatable Fluorescent...
  19. Sequencing Primers

    Type
    Guide
    ...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse ...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC Reverse...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP...
  20. Zhang Lab CRISPR Page

    Type
    Collection
    ...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ... information, please visit the Addgene SAM library page . Targeted gene activation using SAM There are...available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424 were designed...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...
Showing: 141 - 160 of 257 results