Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 260 results for: gfp gene

Showing: 141 - 160 of 260 results

  1. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...sequence between two target sites. Modifying multiple genes at once. Using multiplexed gRNAs can target multiple...simultaneous multiplex editing of six different genes. This system doesn’t rely on any additional or host-dependent...from this paper at Addgene. 9. Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic ...plasmids from this paper at Addgene. Additional Resources on the Addgene Blog Browse Our CRISPR Topic...add multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use...multiplex gRNAs, some being: Using dual nickases to generate a knockout or edit. This can help reduce off-target...

  2. Synthetic Photobiology: Optogenetics for E. coli

    Type
    Blog Post
    ...plasmids from this publication at Addgene. Multichromatic control of gene expression in Escherichia coli...optimized by Tabor’s lab, making light-controlled gene expression in E. coli easier and more robust. Synthetic...used to engineer new pathways with sophisticated gene expression controls. Most cell types do not respond... can be coexpressed for sophisticated control of gene expression. An E. coli light-sensitive two-component...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly... was only about 10-fold, precluding the study of gene expression at very high or very low levels. Schmidl...researchers to better fine-tune the level of output gene expression based on the input light intensity. In...

  3. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...test for your gene of interest may be another method to assess transfection success. GFP is often used...lines and are not used for general plasmid selection. Instead, reporter genes are often employed to easily...conjunction with positive selection to ensure your gene gets targeted to a specific location within the ...used selection markers are listed below: Name Gene Conferring Resistance Cell Types* Mode of Action...use G418. This can be confusing since the neo/kan gene confers G418 resistance; however, like gentamicin...Read More: Plasmids 101: Antibiotic Resistance Genes Plasmids 101: Origin of Replication All Plasmids...the genetic traits of the foreign material and will subsequently pass it on to future generations. Stably...

  4. Multiplexed Overexpression of Regulatory Factors (MORF) collection

    Type
    Blog Post
    ... for gene expression, turning transcription on and off by binding proximal to their target genes. Since...Since gene expression patterns determine everything from stem cell differentiation fate to tumor suppression...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order...from the library to further investigate specific genes and TF isoforms. Due to the size of the collection...use to generate the relevant disease model. Accurate modeling of a disease depends on both genetic and expression... not yet available, just ask an Addgene scientist at help@addgene.org! References and Resources  References...scientific community. Recently, the Zhang lab generated a TF library (aka the MORF Collection) and an ...

  5. Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System

    Type
    Blog Post
    ...that control cell cycle gene expression.  Additional Resources on the Addgene Blog Visit the fluorescent...page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org Find fluorescent protein...work in Lin Tian’s lab at UC Davis is to generate a genetically encoded fluorescent sensor for serotonin...sequence an individual’s genome. But when they find genetic variants, what does that mean? Previous research...of Washington sought to address the effects of genetic variants in a high throughput manner. She helped...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...

  6. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ... also includes a GFP construct as a control. For easier portability, all viral genes are flanked by EcoRI...coronavirus or COVID-19 research, please email Addgene at help@addgene.org with your order number and so it can .... Sign up for email alerts on the Krogan lab's Addgene page to get notified!) Attacking coronavirus, one...reasons, the QCRG is delighted to be partnering with Addgene, who will be taking over the distribution to expand... coronavirus related plasmids and resources at Addgene* Many thanks to our guest bloggers Manon Eckhardt...

  7. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...for the incorporation of phosphoserine into your gene of interest. Depositor...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...phosphoserine into the growing polypeptide chain to generate the new phosphorylated protein. Protein Phosphorylation...by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., 2011). Follow up ...further details in Mohler et al. (2023) and find general tips on phosphoprotein expression in rEcoli XpS...

  8. Hot Plasmids - June 2019 - Optogenetics, Acoustic Reporter Genes, microRNAs, and the CRISPR-Cas9 system CHIME

    Type
    Blog Post
    ...developed four acoustic reporter gene (ARG) plasmids to better monitor gene expression in vivo using ultrasound...non-immunogenic violet-excited GFP variant Vex. To understand the impact of this gene editing tool on the immune...plasmids at Addgene. Liu Q et al., Neuron. 2019. PubMed PMID: 30704911. Acoustic reporter genes for noninvasive...by Lukas Morgan  Listen to the acoustic reporter gene podcast segment In recent years, scientists are ...through a host organism, the expression of some genes can change depending on the location. Current methods...of microbes rely heavily on fluorescent protein genes. These optical reporters have limited deep-tissue...ultrasound. These ARG plasmids contain genes for “gas vesicles,” a gas-filled protein structure that water-bound...

  9. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type
    Blog Post
    ...They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any additional tips,...homology arm as a gBlocks® Gene Fragment from Integrated DNA technologies. Generally speaking, anyone using... an effort to track down every last one of those gene regulatory proteins and the places in the genome...together on several projects and this is one related to gene expression. One goal of the ENCODE project is to...with detailed protocols, go to www.addgene.org/crispr/tagging. Addgene: What motivated you to adapt CRISPR...tagging system, which they’ve now made available at Addgene. For more details on the plasmids that are currently...can now look at many more transcription factors. Addgene: How does the system work? Mendenhall: The system...

  10. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, or both...Karl Deisseroth (Addgene viral prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from... plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral helper sequences...viral vectors are tested in vitro and in vivo for gene expression and/or function. These data are sometimes...copies of the lentiviral Rev responsive element (RRE) gene and the cellular ribonuclease P/MRP 30 kDa subunit...Production AAV distributed by Addgene has been produced either in-house by Addgene scientists or through collaboration...

  11. AAV Molecular Tools

    Type
    Collection
    ...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-...Long Overexpression Tools These AAV encode various genes for overexpression. ID Name Expression System Activity... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Ready-to-use AAV available from Addgene's viral service encoding tet-off transactivators and tools for...

  12. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...Utilization During Gene Targeting with Zinc-Finger Nucleases. G3 Genes Genomes Genetics, 3(4), 657–664. ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...Jaenisch, R. (2013). One-Step generation of mice carrying mutations in multiple genes by CRISPR/CAS-Mediated ...example, choosing target sites that span the knock-in gene. For making mutations, one good way is to mutate...be okay if you are introducing a selection marker gene. The homology arms should be no more than 100 bp...for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper ...Winderbaum, J., Nickoloff, J. A., & Jasin, M. (1998). Gene Conversion Tracts from Double-Strand Break Repair...

  13. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ...into contact with than GFP. Similarly, if the viral vector carries an shRNA to a gene essential for cellular...looks like the genetic cargo in one plasmid (the transfer plasmid), the envelope (Env) gene on a separate...with those particles. Since the Env, Gag, and Pol genes are not encoded in the transfer plasmid, the component...Resources Resources on Addgene.org Addgene viral services Addgene Biosafety Guide Addgene Viral Plasmids ...? That’s okay! In this article we will discuss general viral safety considerations and best practices ...of what is being integrated by the virus. If an oncogene overexpression construct is being delivered, that... and the same holds true for types of viruses generated in the lab. The four most common types of viruses...

  14. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...

  15. Viral Vectors 101: Calcium Sensors

    Type
    Blog Post
    ...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free...Resources on Addgene.org Addgene’s AAV Guide Fluorescent Proteins: Biosensors Addgene’s Viral Services...calcium sensors. Selecting a calcium sensor Genetically encoded calcium indicators (GECIs) are fluorescent...neuronal cell body or the axon (GCaMP6 only). The genetic elements required for Drosophila studies have been...chemical biology. 2021 May;17(5):509-18. Inoue M. Genetically encoded calcium indicators to probe complex brain...Aug 1;169:2-8. Suzuki J, Kanemaru K, Iino M. Genetically encoded fluorescent indicators for organellar...SA, Looger LL. Imaging neuronal activity with genetically encoded calcium indicators. Cold Spring Harbor...

  16. Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards

    Type
    Blog Post
    ...line, Hep3B. From left to right: Mitotracker Red, GFP for the biosensor, Hoechst, and overlay).   ...(DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based biosensors for live cells. His work focuses..., Pedre Pérez’s biosensor fuses MPST to roGFP2. Because roGFP2 contains two cysteines near the chromophore...developed a dual virus system using both optogenetics and chemogenetics to study the activity of parvalbumin...in the lab. He has recently developed a third-generation intensiometric glutamate sensing fluorescent ...catalyzes the desulfuration of 3-mercaptopyruvate and generates an enzyme-bound hydropersulfide that is then transferred...the MPST hydrosulfide can be transferred to the roGFP2 cysteine thiols and change its fluorescence properties...

  17. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ...Cre-lox Control Protein Activity with GFP Resources at Addgene.org Find KTR reporter plasmids Find photoactivatable...spatiotemporal resolution than pharmacological or genetic approaches, but only a few such methods exist and...Solution: In Zhou et al, the Lin lab present a generic design for creating photoswitchable kinases and...possible to create other photoswitchable kinases? The general design of psMEK1 also worked for creating three...PMCID: PMC4097317. Additional Resources on the Addgene Blog Learn More about Photoactivatable Fluorescent...

  18. Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

    Type
    Blog Post
    ...excised by Cre recombinase. Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression...investigation into the regulation of your favorite gene. But have no fear - I’m here to introduce you to...genome – could be affected, leading to unpredicted gene expression changes (Sapozhnikov and Szyf 2021, Charlton...interact with transcriptional machinery to modify local gene expression, confounding any potential conclusions...causal relationship between DNA demethylation and gene expression (Sapozhnikov and Szyf 2021).    ... expressing blasticidin or puromycin resistance genes.  It’s that simple! Good luck and happy editing...Vogelstein B (1983) Hypomethylation distinguishes genes of some human cancers from their normal counterparts...

  19. Split-BioID: An Improved Method for Studying Protein-Protein Interactions

    Type
    Blog Post
    ... enriched relative to controls using Split-BioID-GFP and BioID run on six unrelated proteins. One caveat...study binary protein interactions. However, FRET generally only tells you if two proteins interact and cannot...with your research? Plasmids are available from Addgene! References Schopp, I.M., Ramirez, C.C., Debeljak...Central PMCID: 5053326. Additional Resources on the Addgene Blog Learn about techniques for visualizing protein...-DNA Interactions with CUT&RUN Resources at Addgene.org Find plasmids from the Bethune Lab Find Plasmids...

  20. Validated gRNA Sequences

    Type
    Collection
    ...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...
Showing: 141 - 160 of 260 results