Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 255 results for: tre promoter

Showing: 141 - 160 of 255 results

  1. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...optimized their initial system by using a stronger promoter and different biochemical secondary energy sources...’s lab previously developed such a system in Streptomyces, a prokaryotic genus capable of producing a ...transient reporter for editing enrichment”, or XMAS-TREE, to identify base edited cell populations without...TGG.”  After identification of ABE activity, XMAS-TREE can also be used to purify these modifications and...with them further. The lab demonstrated that XMAS-TREE can be multiplexed and can be used in human pluripotent...Figure 1: Identification and enrichment use of XMAS-TREE. a) Cells are transfected with three different vectors...Quantification of base-editing efficiency using XMAS-TREE-based methods at various genomic loci in four different...

  2. Addgene's a Nonprofit? Nonprofit Awareness Day 2017

    Type
    Blog Post
    ... awareness day, we layout the ways in which we promote our mission and work to enable researchers around...collaboration, and fun Addgene believes there is strength in diversity and in empowering team members to...

  3. Celebrate Open Data Day with Addgene’s AAV Data Hub!

    Type
    Blog Post
    ...the database by certain features like serotype, promoter, or tool type and each entry contains an image...Immunohistochemistry? Did you use any relevant animal treatment conditions like drugs (Chemogenetics) or light...

  4. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  5. Plasmids 101: Origin of Replication

    Type
    Blog Post
    ...express massive amounts of protein given the proper promoter and growth conditions. Choose your origin of...bonds not three as G-C pairs are. As a result, stretches of DNA that are rich in A-T pairs can be separated...against you!  The culture inoculum Freshly streaked bacteria have higher copy numbers – for optimal...also give a higher plasmid yield that colonies streaked from a glycerol stock. Incubation for 12-16 hours...

  6. Advice for Moving Into Sales After Your Science Postdoc

    Type
    Blog Post
    ...alongside the customer. From there a move with either promotions or further education may allow you to transition... and reading some of these articles would have stressed me out more than necessary for my interview. The...mechanisms of cell division. Recently Seán got the entrepreneurial bug and has set up an ELISA kit company on ...

  7. Revamp Your Lab Meetings With Creative Virtual Collaboration

    Type
    Blog Post
    ... Zoom meetings, different tools can be used to promote creative interaction. A great tool that a few people...of work styles while work remotely. The authors stress the fact that “miscommunication, a lack of leadership...of the book “The Salmon Leap for PhDs: Swimming upstream a career from academia to industry”. To date, ...

  8. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...will be suitable). For N-terminus tagging, the promoter region of both the alleles should be sequence-...cautiously analyzed for any damage (indels) to the promoter region of the non-HDR allele. For N-terminal tagging...cuts 8-15 bp downstream of Stop codon; for N-terminus tagging, a crRNA cutting 8-15 bp upstream of your gene...Dewari, a postdoc in Steve Pollard’s lab at the MRC Centre for Regenerative Medicine (CRM), Edinburgh. Most...universal all-purpose “tag antibody” can be used for downstream IP/ChIP assays. Creating epitope-tagged clonal... is a postdoc in Steve Pollard’s lab at the MRC Centre for Regenerative Medicine (CRM), Edinburgh. His...

  9. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...You will have the option to indicate separate promoters, tags, or cloning information for each insert.... 8: Add vector backbone information. List any promoters, cloning details for how your gene was inserted...possible Entrez Gene matches to your insert. Select the appropriate gene if it appears in the Entrez Gene ...associated with your insert. Pro Tip! If the correct Entrez Gene does not appear in the auto-populated list...at a concentration of 0.1–1 µg/µL (or bacterial streaks, if you prefer). If you wish to edit your plasmid...

  10. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...microscope and GFP fusion proteins controlled by promoters specific to the immune lineage, scientists could...Finsterbusch, Michaela, et al. "Patrolling monocytes promote intravascular neutrophil activation and glomerular...that T cells were able to extravasate from the bloodstream to invade lymph nodes and scan antigen presenting...

  11. REPLACR Mutagenesis: Replacing In Vitro Recombination Methods

    Type
    Blog Post
    ...characterize the function of certain regions in a promoter or gene, as well as to study the effects of inactivating...methods, chances are you’d like to find a better one. Trehan et al. wondered if, instead of relying on in vitro... each other; ~17 bases is optimal. After being treated with DpnI to digest away the template plasmid, ...applies to deletions; using REPLACR-mutagenesis, Trehan et al. deleted a whopping 144 kb from a bacterial...recombination. Across all modifications described in Trehan et al., REPLACR-mutagenesis’ median efficiency ... for site directed mutagenesis   References 1. Trehan, Ashutosh, et al. (2016). “REPLACR-mutagenesis:...

  12. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ...fluorescent proteins and is driven by an inducible promoter (Plasmid 64542 or 64543) Before translation, ...cellular function, especially during development or stress. With ribosome profiling, researchers have been...

  13. What Good Citizenship Can Do for Reproducibility in Science

    Type
    Blog Post
    ...forms as part of graduation, hiring, funding, and promotion processes, I’m confident that everyone’s enthusiasm... review and primary research journals including Trends in Cell Biology, Cell, Molecular Cell, Developmental...

  14. The Many Reasons for Irreproducible Research- and a Vaccine to Eradicate It

    Type
    Blog Post
    ... and funders in the Transparency and Openness Promotion Guidelines; preregistration to increase clarity... order, or every combination of materials and treatments is all too often glossed over. This is why it...which data are investigated to look for unexpected trends or differences between groups. Hypothesis generation...hypothesize that growth rates will be higher in treatment versus control, and you think there are four important...

  15. Addgene Welcomes John Doench to the Advisory Board

    Type
    Blog Post
    ...and tech transfer communities who help guide and promote Addgene in its mission to make research easier.... interesting biological questions, you need a tremendous amount of technology development alongside it...what is worth having. The work that [Addgene’s] outreach scientists do to comb through the literature, ...

  16. Cancer, Inflammation and Immunity - Harnessing the Body’s Defenses to Fight Cancer

    Type
    Blog Post
    ...the Francis Crick Institute concluded “Aspirin promotes autophagy, inhibits platelet aggregation, and ... that fasting has a positive effect on cancer treatment (Ref 1). As described in the presentation, starvation...favorable state for tumor progression (Ref 2). Future treatments may need to target this immunosuppressive reaction...

  17. Photosensitizer Induced Cell Ablation with FAP-TAP MG-2I-dL5**

    Type
    Blog Post
    ...visualization and expressed from a heart-specific promoter. Fish were labeled with MG-2I, either by incubating...hearts 24 hours post treatment and no mCer3 cells present 96 hours post treatment (see figure 2). Induced...culture experiments, only dL5**-expressing cells treated with MG-2I dye and exposed to light stained dead...Chromophore-assisted laser inactivation in cell biology. Trends in Cell Biology,18(9), 443-450. doi:10.1016/j.tcb...

  18. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ...Expression is driven by a fairly strong EF1alpha promoter. We have verified expression of correctly-sized...straight-forward. All constructs are tagged with a 2xStrep-tag for easy detection and affinity purification...

  19. Pushing the Limits of DNA Assembly

    Type
    Blog Post
    ...assembly reaction. DNA fragments with the desired promoter, selectable marker, and target gene, for example...and improvements in these methodologies offer streamlined and simplified alternatives to traditional cloning...

  20. Four Factors that Differentiate the Stem Cell Field

    Type
    Blog Post
    ...studying how that one protein interacts with that one promoter can tell you, it can be easy to get lost in the...Fight Rare disease with iPSCs Read About Addgene's Outreach Efforts in the Microbiology Community Sign Up ...
Showing: 141 - 160 of 255 results