We narrowed to 230 results for: crispr c plasmids
-
TypeBlog Post...Biddle, M. S., Alende, C., Fotouhi, M., Jones, C., Ayoubi, R., Southern, K., Laflamme, C., Virk, H., NeuroSGC...T. M., Brown, C., Bandrowski, A., Virk, H., Edwards, A. M., McPherson, P., & Laflamme, C. (2023). Scaling....154034.1 Laflamme, C., McKeever, P. M., Kumar, R., Schwartz, J., Kolahdouzan, M., Chen, C. X., You, Z., Benaliouad...expressed at endogenous levels (Laflamme et al., 2019). CRISPR-Cas9 approaches are commonly used to produce KO... (tagged or untagged) protein When expression plasmids are available, or the necessary expertise to clone...involves the transient transfection of expression plasmids in a given cell line. For flow cytometry, it is..., H. S., Biddle, M. S., Smallwood, D. T., Weston, C. A., Castells, E., Bowman, V. W., McCarthy, J., Amrani...
-
CRISPR Plasmids - Activate Gene Expression
TypeCollection...Activate CRISPR Plasmids: Activate Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick...search the tables below for CRISPR plasmids for transcriptional activation. Plasmids are available for expression...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...PI Publication C. elegans ID Plasmid Gene/Insert Promoter PI Publication Yeast ID Plasmid Gene/Insert Promoter...CRISPR plasmids for activating or upregulating gene expression in various model organisms. CRISPR...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter... -
CRISPR Plasmids - Yeast
TypeCollection... CRISPR Yeast CRISPR Plasmids: Yeast Browse ...Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids that have been designed for use in yeast. CRISPR...Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation ...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter... -
How to Write a Scientific Review Article
TypeBlog Post...Hot Plasmids Articles to See Compiled Info on New Plasmids Review the CRISPR Field with Our CRISPR Guide...perfect. Good luck! References 1. Haery, Leila, Ryan C. Thompson, and Thomas D. Gilmore. "Histone acetyltransferases... -
Validated gRNA Sequences
TypeCollection...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...validated for use in CRISPR experiments. This datatable is compiled from plasmids in Addgene's database...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...Addgene plasmid #52962 ) and is described in Improved vectors and genome-wide libraries for CRISPR screening...heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable cell pool: see our protocol for... -
CRISPR Plasmids - Bacteria
TypeCollection... CRISPR Bacteria CRISPR Plasmids: Bacteria...following CRISPR plasmids have been designed for use in bacteria. Cut Fully functional CRISPR/Cas enzymes...efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...G (or T->C on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase...CRISPR plasmids that have been designed for use in bacteria. CRISPR...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...CRISPR Plasmids: Mammalian Expression The following CRISPR plasmids have been designed for use in mammalian...NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR Plasmids By Function...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids that have been designed for use in mammalian systems. CRISPR...evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post...research? Check out Brainbow plasmids available from Addgene! Find Brainbow Plasmids @Addgene: Brainbow 1.0...1.0, 1.1, 2.1 plasmids Brainbow 3.0, 3.1, 3.2 plasmids References: Transgenic strategies for combinatorial...CRISPR-Cas9 genome editing may be the hot new way to manipulate gene expression, but other gene manipulation... of Cre-lox. Check out our previous blog post, Plasmids 101: Cre-lox, if you need a quick primer on how...Sato T, van Es JH, van den Born M, Kroon-Veenboer C, Barker N, Klein AM, van Rheenen J, Simons BD, Clevers...melanogaster. Hadjieconomou D, Rotkopf S, Alexandre C, Bell DM, Dickson BJ, Salecker I. Nature Methods. ... -
CRISPR Plasmids - Plants
TypeCollection... CRISPR Plants CRISPR Plasmids: ...Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR expression plasmids that have been designed for use in plants. CRISPR...: Plants Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter... -
Visualizing Protein Turnover In Situ
TypeBlog Post...Fluorescent protein plasmids Use FRET to study protein-protein interactions Deposit plasmids with Addgene! ...Tagged protein can easily be overexpressed from a plasmid but overexpression may interfere with the system...translation in living single cells. However, before CRISPR-Cas9 these techniques were quite tedious and, even...ti2learning.org. References 1. Dieterich, Daniela C., et al. "In situ visualization and dynamics of newly... -
CRISPR History and Development for Genome Engineering
TypeCollection...like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows no...out Addgene’s CRISPR Guide and CRISPR blog posts , or find CRISPR plasmids for your research. Addgene has... CRISPR CRISPR History CRISPR History and Development for Genome Engineering You may also like...sequencing, CRISPR is a robust system for genome-wide screening. CRISPR Technological Advances CRISPR technology...finger nucleases (ZFNs) and TALENs. CRISPR: An Adaptive Immune System CRISPR (Clustered Regularly Interspaced...prokaryotes used CRISPR as part of an adaptive immune system - utilizing various CRISPR-associated (Cas...of DNA known as CRISPR arrays. Separate Cas proteins then express and process the CRISPR loci to generate... -
CRISPR Pooled gRNA Libraries
TypeCollection... CRISPR Pooled Libraries CRISPR Pooled Libraries Browse CRISPR Plasmids By Function Genome...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols... (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637 Broad GPP Humagne Set C and...Protocols gRNA Design Tools CRISPR Blog Posts CRISPR is a useful tool for genetic screening experiments...virtually any genetic locus. CRISPR pooled libraries consist of thousands of plasmids, each containing multiple...experiments using a pooled CRISPR library are far more complex than using CRISPR to modify a single genomic...steps for using pooled CRISPR libraries and keep the following in mind: CRISPR screening experiments require... -
Fluorescent Protein Travel Awards - FLiPs and Fluorescent Protein Biosensors
TypeBlog Post...Photosactivatable Fluorescent Proteins Use Light to Control CRISPR Genome Editing Choose the Brightest Fluorescent...Addgene.org Find Fluorescent Protein Biosensors Browse Plasmids from the Tsien Lab Browse the Michael Davidson...light. Previous iterations of FLiPs only used N- and C-terminal dronpa fusions. With these various designs... -
Hot Plasmids February 2024
TypeBlog Post...of the new plasmids, antibodies, and viral preps in the repository through our Hot Plasmids articles. ...all applications. Addgene’s plasmid collection includes over 10,000 plasmids with a FLAG tag (!), but did...cells By Susanna Stroik Even with the advances in CRISPR technology over the past decade, primary cells ... al. 2023 with permission. Find Cas-PAGE plasmids here! Zhang, Z., et al. (2023). Efficient engineering...inspired and informed this section. Find mStayGold plasmids at Addgene here! Ando, R., et al. (2023). StayGold...under CC-BY license. Find the AAV.CAP-Mac plasmid here! Chuapoco, M.R., Flytzanis, N.C., Goeden...(2023) under CC-BY license. Find AAV1-X1 plasmid here! Chen, X., et al. (2023). Functional gene ... -
Quick Guide to All Things Lentivirus
TypeBlog Post...virus (MoMLV) and consisted of two plasmids: the packaging plasmid containing all the structural genes...crossover event between the vector plasmid and the packaging plasmid caused the Psi sequence to be placed...expression of the transgene Transfer plasmids The transfer plasmid is the vector you clone your gene of...usually 293T cells, with your transfer plasmid and your packaging plasmids. For this, you can use the transfection... additional protocols and plasmids. References 1. Miller, A. DUSTY, and C. A. R. O. L. Buttimore. "Redesign...vectors fantastic options for delivering shRNA, CRISPR/Cas9 components, and fluorescent sensors. Retroviral...techniques are still used and efficiently transfer plasmid DNA efficiently into dividing immortalized cells... -
Rett Syndrome
TypeCollection... using plasmids, please see Addgene's Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources... Syndrome Plasmid Collection and Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids...selection of plasmids expressing Cas9 and empty gRNA backbones. A few examples of additional CRISPR resources...Editing CRISPR-based DNA methylation editing system - Shawn Liu and Rudolf Jaenisch labs Plasmids MECP2 ...MECP2 Plasmids The table below highlights plasmids that express or target the MECP2 gene. Use the search bar...window) C-terminal Anti-MECP2 (M6818) mouse antibody from Sigma (Link opens in a new window) C-terminal... -
Plasmids for Stem Cell Research
TypeCollection... Plasmid Collections Plasmids for Stem Cell Research Plasmids for Stem Cell Research...Reprogramming Plasmids Differentiation and Transdifferentiation Plasmids Stem Cell Research Plasmids Stem cells...utilize plasmids to increase expression of key factors. The tables below will help you find plasmids available...information page. Reprogramming Plasmids Browse the table below for plasmids used to create induced pluripotent...RNA p53 for single plasmid reprogramming Novel codon-optimized mini-intronic plasmid for efficient, inexpensive...Differentiation and Transdifferentiation Plasmids Browse the table below for plasmids used for differentiation of ...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...effects of CRISPR. Browse, sort, or search the tables below for CRISPR-FokI plasmids. Plasmids are available...FokI CRISPR: dCas9-FokI Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids with dCas9 fused to FokI for creating double-strand breaks (DSBs). CRISPR...Drosophila. Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter...Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids that should... CRISPR dCas9-FokI ... -
CRISPR Plasmids - Epigenetics
TypeCollection... CRISPR Epigenetics CRISPR Plasmids: Epigenetics Browse CRISPR Plasmids By Function Genome...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...Browse, sort, or search the tables below for CRISPR plasmids for epigenetic modification in mammalian or...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Protocols gRNA Design Tools CRISPR Blog Posts To make targeted epigenetic modifications, researchers have...