Skip to main content

We narrowed to 3 results for: TRE3G

Showing: 1 - 3 of 3 results
  1. Tetracycline Inducible Expression

    Type
    Collection
    ...al., 1994). TRE3G promoter : also optimized into P TRE3GV for viral expression and P TRE3GS for all-in-...miR-E (miR-30 variant)-based backbone rtTA-Advanced TRE3G Johannes Zuber 60495 pSBtet-GP Sleeping Beauty transposon... for inducble expression of EGFP Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP Lentiviral...for inducible expression of EGFP Tet-On 3G rtTA TRE3GS Jason Sheltzer 11651 pLVUT-tTR-KRAB Lentiviral ...Tet-OsTIR1-PURO) Expresses OsTIR1 under the control of a TRE3GS promoter for conditional auxin-inducible degron...interest fused with 3xFLAG and 2xStrep-tag from TRE3G promoter for Tandem-Affinity Purification. Yannick...
  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...mNeonGreen TRE3GS Parkinson's Patrick Caswell 179900 pJET-59-DExCon-mTagBFP2-R25 RAB25 mTagBFP2 TRE3GS Parkinson's... BFP TRE3G Alzheimer's, ALS Eran Hornstein 229082 PiggyBac-APEX-V5-NES TARDBP V5, APEX, BFP TRE3G ALS ...Galloway 235303 pLentiX1-[TRE3G-FXN-P2A-mRuby2-bGH]-EFS-rtTA-P2A-mGL-WPRE FXN mRuby2 TRE3G Friedreich ataxia ...pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH]-EFS-rtTA-P2A-mGL-WPRE FXN mRuby2 TRE3G Friedreich...pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH]-EFS-rtTA-P2A-mGL-WPRE FXN mRuby2 TRE3G Friedreich...
  3. Validated gRNA Sequences

    Type
    Collection
    ...GGGAAAACACAACCGCAGCC 42249 cut S. pyogenes 23360964 Joung TRE3G H. sapiens GTACGTTCTCTATCACTGATA 62325 scaffold ...
Showing: 1 - 3 of 3 results