Addgene

This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

We narrowed to 4 results for: gsk3b

Showing: 1 - 4 of 4 results

Guide RNA Expression Plasmids for Endogenous Zebrafish Genes

Type

Collection

...]) 42245 DR338 (gRNA targeted to zebrafish gene gsk3b ) 42246 DR311 (gRNA targeted to zebrafish gene rgs4...
mTOR Pathway

Type

Collection

...MTOR associated protein; LST8 homolog GSK3 GSK3A GSK3B Glycogen synthase kinase 3 MDM2 MDM2 proto-oncogene...
Validated gRNA Sequences

Type

Collection

...GCCCAGCCTCCGCACCTACA 61833 cut S. pyogenes 24424410 Ye gsk3b D. rerio GGGACCTGACCGGCCGCAGG 42245 cut S. pyogenes...
Immunology Research Plasmids and Resources

Type

Collection

...osteosarcoma viral oncogene homolog AP-1, C-FOS GSK3B glycogen synthase kinase 3 beta - HRAS v-Ha-ras ...

Showing: 1 - 4 of 4 results

Guide RNA Expression Plasmids for Endogenous Zebrafish Genes

mTOR Pathway

Validated gRNA Sequences

Immunology Research Plasmids and Resources

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections