Skip to main content
Addgene
Showing: 1 - 4 of 4 results

  1. Cre-lox system

    Type
    Collection
    ...Mammalian Green 8406 p252 pPr-CREM/CMV-STOP-luc CREM and CMV-STOP-luc cassette probasin Mammalian Green 8408...8408 p255 pPr-CREM/Ins/CMV-STOP-luc CREM and CMV-STOP-luc cassette, separated by insulator probasin Mammalian...neurons Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer...Hescheler 12463 p231 pCMVe-betaAc-STOP-luc Cre dependent luciferase expression Mammalian Green 32145 pJFRC172...AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV...8394 p209 pCMV-cre-K Cre-K CMV Mammalian Green 8395 p210 pCMV-CREM CREM CMV Mammalian Green 8401 p224 pCMV-RFP...Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian...

  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...NRAS1 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 MGC130000, MGC130001, PAKalpha PAK2 p21 protein (...PAK3beta, bPAK, hPAK3 PAK4 p21 protein (Cdc42/Rac)-activated kinase 4 - PAK6 p21 protein (Cdc42/Rac)-activated...GTP binding protein Rac1) MGC111543, MIG5, TC-25, p21-Rac1 RAC2 ras-related C3 botulinum toxin substrate...v-ras) oncogene homolog ALPS4, N-ras, NRAS1 PAK1 p21 protein (Cdc42/Rac)-activated kinase 1 MGC130000,...Cdc42/Rac)-activated kinase 2 PAK65, PAKgamma PAK3 p21 protein (Cdc42/Rac)-activated kinase 3 CDKN1A, MRX30...activated kinase 6 PAK5 PAK7 p21 protein (Cdc42/Rac)-activated kinase 7 KIAA1264, MGC26232, PAK5 PDCD1 programmed...

  4. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes 23287722 Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S. pyogenes...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...
Showing: 1 - 4 of 4 results