Skip to main content

We narrowed to 839 results for: Cat

Showing: 401 - 440 of 839 results
  1. Using Addgene's New Viral Service for Your Research

    Type
    Blog Post
    Published
    Nov. 17, 2016, 3:30 p.m.
    ... and testing so that researchers can use our educational resources and experience to their advantage should...preparations have worked well in my lab, including in applications where we have delivered them in vivo to the ... help! We’ve been expanding our viral vector educational resources as well, with both posts on the blog...distributing new types of materials. At the time of publication we’ve already fulfilled more than 140 orders ... service as we continue to develop it. More communication and sharing will only help research advance....
  2. Identifying Sequence Elements with SnapGene's Feature Database

    Type
    Blog Post
    Published
    Dec. 21, 2017, 2:06 p.m.
    ...features such as antibiotic resistance markers and replication origins, but there is extensive heterogeneity...microbial strains. It proved to be impractical to catalog every variant of a feature. Instead, we identified...occasional mismatches or indels. Empirical tests indicated that a reasonable rule is to require at least ...that have different properties. To prevent misidentification, we augment the database with new fluorescent...protein variants. The future of DNA feature identification What’s next for common features? We plan to...
  3. Three Tips for Preventing Viral Plasmid Recombination in Your Samples

    Type
    Blog Post
    Published
    Sept. 14, 2021, 1:15 p.m.
    ... (AmpR) and origins of replication (ori and f1 ori) which allow it to replicate.   How can I prevent...the bacterial selection marker and origin of replication. During bacterial culture, only the plasmid with...the antibiotic resistance gene and origin will replicate, and the transgene will be lost. Over time, bacteria...the recombined plasmid is still visible. This indicates that the DNA prep contains a mixture of the full...
  4. Natural or synthetic? How Addgene’s dataset reveals trends in biological innovation

    Type
    Blog Post
    Published
    Nov. 8, 2018, 3:47 p.m.
    ...published their results in a paper in Nature Communications announcing a new bioinformatics tool that can...at its sequence. MIT collaboration for gene classification This inquiry started when Neil Thompson, a ...have generated robust tools that have practical applications in monitoring the accidental or intentional ...from farther away in the tree of life." Nature communications 9.1 (2018): 4425. PubMed PMID: 30356044. PubMed...the lab-of-origin of engineered DNA." Nature communications 9.1 (2018): 3135. PubMed PMID: 30087331. PubMed...
  5. Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools

    Type
    Blog Post
    Published
    Sept. 18, 2018, 1:33 p.m.
    ...cells, and has potential use for a wide range of applications in cellular biology. Van Haren J et al. Nature...versatile in vivo fluorescent reporter for rapid quantification of base-editing and Cas9 cleavage activity ...plasmid that allows for rapid fluorescence-based quantification of base editors that utilize dCas9 fused to... The reporter constitutively expresses eGFP to indicate reporter abundance, and mCherry fluorescence is...frame-shift mutation within the mCherry reporter. Quantification of editing efficiencies simply involves tracking...
  6. Comparing Cas9 to NgAgo: Can the Argonautes Best CRISPR?

    Type
    Blog Post
    Published
    June 9, 2016, 2:30 p.m.
    ...template is supplied. Find Plasmids from the NgAgo Publication at Addgene Cas9 and NgAgo head to head NgAgo ...differences in cleavage efficiency. If this finding is replicated in larger studies, it will represent a key advantage...site specified by the gDNA. Depending on your application, this could be favorable or unfavorable. In a...PubMed PMID: 27136078. Find plasmids from this publication at Addgene. 2. Swarts, Daan C., et al.  “DNA-... PMCID: PMC4697943. Find plasmids from this publication at Addgene. 3. Swarts, Daan C., et al. “Argonaute...
  7. Hot Plasmids: FRET-Based Biosensors

    Type
    Blog Post
    Published
    May 6, 2014, 1:07 p.m.
    ...Neurobiology has been working on genetically encoded indicators of calcium and other small molecules since the...lymphocytes, too, making them a versatile tool for application in both neuroscience and immunology. Don’t be...imaging for beginners Griesbeck says his calcium indicators can be used in mouse, Drosophila, C. elegans,...give it a shot. “Beginners sometimes think it’s complicated, but actually it is very good,” he said. “It ...his team is now applying it to improve upon an indicator they developed and published in 2010 for visualizing...
  8. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    Published
    Jan. 19, 2021, 2:15 p.m.
    ...tool that can be used for a variety of research applications. Within the immune system, antibodies are produced...antibodies to bind proteins is useful for research applications as well because they allow scientists to target...150 kDa, a nanobody is 12-15 kDa.   Research applications for antibodies You can use antibodies for experiments...Let’s dive in and take a look at some of these applications. Western blot Western blots are used to detect... by binding to cell surface receptors. These applications are typically used for investigating signaling...are out there, and how many different research applications they can be used for. Addgene’s Antibody Plasmid...
  9. Pushing the Limits of DNA Assembly

    Type
    Blog Post
    Published
    Sept. 6, 2017, 1:01 p.m.
    ...-guide RNAs – but it also allows you to skip purification steps and end-repair steps with well-designed...that the region of homology doesn’t have to be located at the absolute end of a fragment. This means that...fragment sequences and the polymerase used in the amplification. This tool allows instant updates as fragments...transforma­­­tion or as a PCR template. Some of the applications of the NEBuilder HiFi DNA Assembly Mix include...the limitations associated with otherwise more complicated assembly approaches, and opens the door for new...
  10. Fluorescent Protein Travel Awards - FLiPs and Fluorescent Protein Biosensors

    Type
    Blog Post
    Published
    July 27, 2017, 1:11 p.m.
    ...researcher and science communicator.  Update (7/17/2018): Check out Fatima's recent publication on her HMO work...protein-protein interactions. Beyond these common applications, researchers are finding new ways to apply fluorescent...utility of these FLiPs in a variety of research applications and particularly notes their ability to be precisely...endeavors, Fatima hopes to practice her science communication skills throughout her training and wants to ...
  11. Science Career Options

    Type
    Blog Post
    Published
    Feb. 23, 2017, 1:30 p.m.
    ...Marketer Software Developer Learn Science Communication Skill from a Student Group Like Science in the...regular travel be required or will you stay in one location? How long is the commute? Will the job require...online job websites to see what requirements or qualifications are needed for the role, as this will give ...your research, it’s time to start sending out applications. Check out our other career posts for more specifics...careers and to find advice on crafting the perfect application. Additional Resources on the Addgene Blog Learn...
  12. Learning Technical Skills at a Lab Central Workshop

    Type
    Blog Post
    Published
    Feb. 20, 2018, 2:30 p.m.
    ...processing, these small DNA strands can form concatemers in later steps. This new NEB kit includes a step...fragments the DNA and prevents it from forming concatemers later. The "FS" stands for Fragmentation System...repair Adapter Ligation Clean up/Size selection Amplification Clean up  I found this kit easy to use because...DNA we started the process with, we got great amplification of our sample libraries. NEB also gave us a ...mostly used to make new libraries as opposed to replicating them like we do at Addgene), going to the workshop...
  13. Plasmids 101: Gram Negative and Positive Bacteria

    Type
    Blog Post
    Published
    Aug. 2, 2022, 1:15 p.m.
    ...ll be talking about the ins and outs of this classification system, including its history, biology, and...repeatable phenomenon, Gram began using it as a classification system. Eventually, any bacteria that retained...permeable to different classes of antibiotics. The classification system is also useful in a laboratory setting...bacteria type. The gram positive and negative classification system is incredibly helpful in visualizing...stepping into a lab.   Anna Kamens is a science communication summer intern at Addgene and a rising third-...
  14. Luminescent Imaging with Nano-lanterns

    Type
    Blog Post
    Published
    May 25, 2017, 2:30 p.m.
    ...resulting in a fluorescent signal. Since their first publication in 2012, the Nagai laboratory has assembled a...multicolored nano-lanterns for use in various applications, including optogenetics, biosensors, and fusion...sensitivity and faster imaging compared to previous publications. They also developed calcium, cAMP, and ATP ...furimazine. In addition to the previously described applications, the enhanced signal of eNL allows their use...characterizing Nano-lanterns and eNL for many different applications. For long-term imaging, especially where photobleaching...
  15. AAV Q&A with Tim Miles

    Type
    Blog Post
    Published
    May 17, 2022, 1:15 p.m.
    ... our knowledge. Disease Applications Q13: Does AAV have potential applications in diseases which may be...Did you catch our April AAV webinar with Tim Miles, PhD, Director of the CLOVER Center at CalTech? If...1x1014 vg/ml.. As evident in our repository, this application is an outlier for PHP.eB (1x1011 - 1x1012 vg/...CRISPR tools is an exciting area for future AAV application to epigenetic editing. This area is discussed...
  16. From Lab Bench to Leadership: Transitioning into Management as a PhD

    Type
    Blog Post
    Published
    Jan. 21, 2025, 2:15 p.m.
    ...cohesive team environment. Neglecting communication skillsClear communication is the backbone of effective management...management. Miscommunication often arises when managers fail to set expectations or provide timely feedback...firsthand when it took me some time to adapt to the communication style of a new, junior team member who had values...and leveraging tools like the Myers-Briggs Type Indicator or DISC assessments can help you navigate team...
  17. Viral Vectors 101: Biosensors

    Type
    Blog Post
    Published
    July 6, 2023, 1 p.m.
    ...of the biosensors used in research are very sophisticated, but at their core they can all be boiled down...ready-to-use. While biosensors span the gamut of applications within chemistry, biology, and physics, in this...sensors can be targeted to different cellular locations or tissues depending on the biology you are studying...different factors, in different or the same cellular location, all at once! Small molecules What type of small...Neurotransmission and Neuromodulation: Engineering and Applications. Frontiers in Cellular Neuroscience. 2019 Oct...
  18. Why and how to start studying chromatin (with Addgene's help)

    Type
    Blog Post
    Published
    June 12, 2018, 11:40 a.m.
    ...transcription, or DNA repair, or replication, or any number of CRISPR applications and thought “OK, but how does...pages containing lists of plasmids from the indicated publications. You can request all of these plasmids ...below pull up lists of plasmids containing the indicated gene, and you can subscribe to these pages to ...
  19. Cas13d: Small RNA-targeting CRISPR enzymes for transcriptome engineering

    Type
    Blog Post
    Published
    May 3, 2018, 1:48 p.m.
    ...for pre-clinical and clinical applications of dCasRx. The identification of Type VI Cas13d enzymes is ...RspCas13d. RspWYL1 also increased EsCas13d activity, indicating that WYL domain-containing proteins may be broader...even when guides were tiled across a target RNA, indicating that this enzyme does not cleave at a predictable...target essentially any RNA in a cell. Since catalytically dead dCasRx maintains its RNA-binding properties...
  20. Human Germline Editing Using CRISPR

    Type
    Blog Post
    Published
    Aug. 10, 2017, 2:19 p.m.
    ...thus allowing repair to take place before DNA replication. Indeed, they observed that 41/42 embryos were... embryos carried indels at the mutation site, indicating that repair proceeded through NHEJ rather than...attributable to CRISPR editing. Conclusions & implications One striking feature of this paper is the failure... need to be much, much lower before clinical applications could be considered. It is important to consider...experiments are needed before we can consider clinical applications for germline editing. Although this paper represents...
  21. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

    Type
    Blog Post
    Published
    June 15, 2017, 2:30 p.m.
    ...aggregates. This property can be tolerated in some applications (e.g. labeling of cells or tracking promotor...promotor activity), but it is problematic in applications in which the fluorescent protein is used as an inert...During the experiment, the solution is diluted, complicating the interpretation. Because of this, these methods...aware that the fluorescent proteins reported in publications are only characterized under a limited number...build a valuable resource with tools and data that indicate the performance of (a set of) fluorescent proteins...
  22. RNA Extraction Without A Kit

    Type
    Blog Post
    Published
    March 24, 2020, 1:15 p.m.
    ...of DNA that can potentially complicate results of a downstream application such as quantitative PCR to...easier. Recently, we published a blog on DNA purification without a kit that outlined several reasons ...take care whenever doing any type of DNA or RNA purification to avoid contamination, take extra care when..., that isn’t the case for RNA extraction and purification. There is one simple method that works, and ...
  23. Supporting Rare Disease Research with the 2020 BeHEARD Awards

    Type
    Blog Post
    Published
    Sept. 8, 2020, 2 p.m.
    ...seizures, and other symptoms as discussed in this educational video. “SLC6A8 belongs to a large family of solute.... “This proof of concept study will help in identification of new targets that could greatly enhance our...professor and assistant dean of biomedical science education at McGill University.  These protein-receptor ...58 individuals with GNB1 disorder since the identification of this disease in 2016. The lab aims to “expand...pathways using biosensors as well. “The Addgene catalog would allow us to enhance our biosensor repository...
  24. The Breast Cancer Microenvironment: A Tumor’s Backstage Team

    Type
    Blog Post
    Published
    Jan. 31, 2019, 1:32 p.m.
    ... these stromal cell modifications, stromal cells are also constantly communicating with a tumor, proving... was contributed by Bárbara Pinho, a science communicator at the Portuguese science museum "Fábrica Centro...Proficient in transportation, exosomes are tools of communication and provide malignancy to the microenvironment... Pinho! Bárbara Pinho is currently a science communicator at the Portuguese science museum "Fábrica Centro...
  25. Viral Vectors 101: An Introduction to AAV

    Type
    Blog Post
    Published
    May 30, 2023, 1:15 p.m.
    ...experiments. Recombinant AAVs (rAAVs) The primary application of AAV is delivery of genetic cargo to a host...numerical designations, separated by a slash, that indicate the ITR and serotype, respectively. For example...transduced gene is episomal and does not divide and replicate in the same way the host DNA does. Because of ... since you don’t have to wait for the host to replicate the DNA before expression. Now that you’ve got... S., et al. “Various AAV Serotypes and Their Applications in Gene Therapy: An Overview.” Cells, 12(5),...
  26. Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

    Type
    Blog Post
    Published
    Sept. 26, 2019, 12:50 p.m.
    ...including RNPs for indel formation via NHEJ, precise modification with Homology Directed Repair (HDR), CRISPR ...potential to be used for other types of CRISPR applications. Let’s take a look at the key components of ... which means they are non-infectious and non-replicative. Nanoblades are produced by transfecting the ...incubating Nanoblade particles with polybrene, a cationic polymer. Polybrene has long been used to increase...with Cas9-sgRNA ribonucleoproteins." Nature communications 10.1 (2019): 45. PubMed PMID: 30604748. PubMed...
  27. Mouse Modeling, Part 2: Breeding and Crossing Mice

    Type
    Blog Post
    Published
    Aug. 6, 2019, 12:55 p.m.
    ...techniques that can be used to introduce genetic modifications into mouse embryos. But once you generate a ...techniques are each useful for introducing one modification into the mouse genome, they are not commonly...parental mice In order to ensure that your genetic modification will be passed along to all of the offspring...environment and will harbor similar epigenetic modifications. Special breeding cases Whether your mouse colony...the mutations that you are trying to cross are located on homologous chromosomes in the parental generation...
  28. Mouse Modeling, Part 1: Genetically Engineered Mice

    Type
    Blog Post
    Published
    July 11, 2019, 1:26 p.m.
    ...stimuli. Cre recombinase catalyzes the recombination of DNA sequences located between two loxP sites. ...in research can fall under one of two broad classifications: inbred or outbred. Inbred strains share a ...Knockout mice Knockout mice have undergone genetic modification that alters or eliminates the expression of ...can be used to invert a segment of DNA or to translocate a piece of DNA from one region of the genome ...
  29. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    Published
    March 23, 2021, 1:15 p.m.
    ...2021.   The potential tools fall into two categories: probes and editors. A probe array may consist...and should be varied as it can have important implications for the fusion protein effectivity), and a fluorescent...to visualize DNA, an editor targets DNA (via catalytically inactive dCas9) to modify chromatin. A fluorescent...both spatiotemporal protein degradation and quantification of this depletion using imaging-based measurements...BioTag, which can be used in protein affinity purification studies.    Duong et al., Genetics 2021. https...
  30. Split-BioID: An Improved Method for Studying Protein-Protein Interactions

    Type
    Blog Post
    Published
    May 1, 2018, 1:57 p.m.
    ...methods for identifying PPIs, such as affinity purification mass spectrometry (AP-MS), lack the ability ...the validation of a binary PPI as well as the identification of additional interacting factors. Problems...detect weak and/or transient PPIs. Many PPI identification techniques rely on protein interactors to stay... AP-MS. This requirement often prevents the identification of weak and/or transient interacting proteins...spatiotemporally defined protein complexes. Nature communications. PubMed PMID: 28585547. PubMed Central PMCID...
  31. 5 Tips for Troubleshooting Viral Transductions

    Type
    Blog Post
    Published
    Aug. 11, 2016, 2:23 p.m.
    ...experiment and they don't do anything. Viruses are complicated and they perform complex biological tasks, both...vector may undergo genomic rearrangements during replication. To avoid genomic rearrangements, try amplifying...membranes (Davis et al., 2002). Polybrene is one such cationic reagent that is commonly used and has been shown... during transfection, and does not necessarily indicate the production of virus. Alternatively, if the...hepatitis B virus DNA and hepatitis C virus RNA quantification as measured with branched-DNA technology." ...
  32. Fluorescent Proteins 101: Visualizing Subcellular Structures & Organelles

    Type
    Blog Post
    Published
    June 22, 2017, 2:30 p.m.
    ...functionality can be gained by understanding the location and transport of the protein within a living cell...to observe membrane trafficking events in vivo. Locate your protein and see who it is hanging out with...potential overlap, it is possible to determine the location of proteins within complex structures. In order...way it is important to choose the appropriate quantification methods and tools. It is usually not enough...intracellular pathogens In addition to tracking the location of proteins it is also possible to follow the ...
  33. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    Published
    May 4, 2017, 2:30 p.m.
    ... (green or blue) within a population of timer indicates the age of the pool: the higher the ratio, the...-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT -  Applications of fluorescent protein timers FP timers have...biological event (trafficking to a subcellular location, start of gene expression, development of a cell... insulin-secreting beta-like cells." Nature communications 7 (2016). PubMed PMID: 27063289. PubMed Central...Learn More About Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your...
  34. Google Forums Round Up: First Impressions of NgAgo

    Type
    Blog Post
    Published
    Aug. 4, 2016, 2:30 p.m.
    ...been excitedly testing NgAgo's genome editing applications. So, how does NgAgo stack up thus far? A few...survey. When asked if they could detect indels (an indication of gene disruption ability) with NgAgo, one respondent...could not achieve indels with the NgAgo system indicates that it is very tricky to use and fussy to optimize... S. Lander, and Feng Zhang. "Development and applications of CRISPR-Cas9 for genome engineering." Cell...Addgene.org Request NgAgo Find CRISPR Resources Catch Up on Your CRISPR Background ...
  35. Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More

    Type
    Blog Post
    Published
    June 12, 2014, 3:30 p.m.
    ...? Patron: Sainsbury has a mandate to share and educate and enable plant science in general. We are funded...easier because individual labs will not need to ‘domesticate’ all the basic and necessary elements in order... you are in the lab. There is no PCR, no gel purification; the whole cloning process is so simplistic ...tweet about plant synthetic biology, science communication, women in science, and many other topics. What...well-rounded human beings. It’s also a great communication tool for work. Most Sainsbury scientists are...
  36. Drew Endy Introduces the Biobrick Public Agreement Plasmid Collection

    Type
    Blog Post
    Published
    Dec. 12, 2013, 3:35 p.m.
    ...Initiative. Endy's team made news in March with a publication in Science describing the development of “transcriptors...work, and it begins with the central dogma - replication of DNA, transcription of DNA to make RNA, translation..., humans have two types of languages: one to communicate amongst each other, like this conversation we... in English, and then there are languages to communicate with other things. These are programming languages...successful in the long term, if it's going to communicate between humans (i.e., our dreams and intentions...
  37. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    Published
    March 13, 2014, 4:08 p.m.
    ...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...
  38. MXS Chaining

    Type
    Blog Post
    Published
    Feb. 7, 2017, 3:30 p.m.
    ...develop diverse fluorescent reporters is a useful application of high-throughput cloning. MXS Chaining is one...plasmids for fluorescence imaging or flow cytometry applications in mammalian cells. The modules used in this...transgene expression, or a variety of other clever applications. In one example, modular constructs generated...methods are suited for particular downstream applications. The tradeoffs between various cloning methods...technique to engineer various constructs with applications in flow cytometry approaches in mammalian cell...
  39. Transferable Skills Guide: Identifying Your Transferable Skills

    Type
    Blog Post
    Published
    Jan. 11, 2018, 3:29 p.m.
    ...my job. The same can be said about teamwork, communication, writing, management, and creativity; I have...have the desired degree, you have mastered the applications they use, you’ve gained experience working with...to solve a problem. When they ask about your communication style, your potential teammates want to be assured...ve had to flex your conflict management and communication skills quite a bit. Grab a piece of paper and...Negotiation Career Planning Resources Cross team communication  External collaborators For further advice ...
  40. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    Published
    May 2, 2019, 12:41 p.m.
    ... their organismal systems for scientists and educational programs for K-12 students. You can see why I...parenting strategies and make important ecological indicators since species live in water and on land. Current...which have been used to treat heart disease. Caterpillars that eat milkweed generate cardenolides that... poisonous) for bird predators - birds eat a caterpillar once, vomit, and never do it again. Cichlids ... expensive. They are using a cool fluorescent indicator system to rapidly identify recombinants. Arthropods...
Showing: 401 - 440 of 839 results