Skip to main content
Addgene

We narrowed to 27 results for: Myc-tagged Cre

Showing: 21 - 27 of 27 results
  1. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...an anti-FLAG antibody to immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9... in the DNA. Indels often lead to frameshifts, creating loss of function alleles. To introduce specific...adenine to inosine, which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations...breaks in DNA instead of the double-strand breaks created by wild type Cas enzymes. To use a nickase mutant...your DNA in close proximity. These double nicks create a double-strand break (DSB) that is repaired using...fused to a transcriptional activator peptide can increase transcription of a specific gene. Design your ...
  2. Validated gRNA Sequences

    Type
    Collection
    ...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...
  3. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... in the DNA. Indels often lead to frameshifts, creating loss of function alleles. To introduce specific...breaks in DNA instead of the double-strand breaks created by wild type Cas enzymes. To use a nickase mutant...your DNA in close proximity. These double nicks create a double-strand break (DSB) that is repaired using...fused to a transcriptional activator peptide can increase transcription of a specific gene. Design your ...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6...
  4. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...another round. Figure 1: Overview of prime editing. Created with BioRender.com. The original prime editing ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...
  5. CRISPR Plasmids - Plants

    Type
    Collection
    ... Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... in the DNA. Indels often lead to frameshifts, creating loss of function alleles. To introduce specific...adenine to inosine, which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations...breaks in DNA instead of the double-strand breaks created by wild type Cas enzymes. To use a nickase mutant...your DNA in close proximity. These double nicks create a double-strand break (DSB) that is repaired using...fused to a transcriptional activator peptide can increase transcription of a specific gene. Design your ... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids...
  6. Lentiviral Prep Service

    Type
    Collection
    ...Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes involved in specific...carrying version 1 of the CellTag barcoding library. Version 1 of the Celltag library contains 19973 barcodes...carrying version 2 of the CellTag barcoding library. Version 2 of the Celltag library contains 4934 barcodes...carrying version 3 of the CellTag barcoding library. Version 3 of the Celltag library contains 5737 barcodes... genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled library ... genes along with 1000 non-targeting controls Puromycin Doench , Root Human activation pooled libraries...56,762 unique sgRNAs targeting 18,885 human genes Puromycin Doench , Root Human inactivation pooled libraries...
  7. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... Bauer's labs details the use of CRISPR/Cas9 to create genomic deletions in mammalian cell lines. Along... pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order...joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given...strategies for genes and non-coding elements. For creating a gene knockout, two sgRNA located within exons...Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively, or constructs...be 24-mer oligos ( Table 4 ). Design Deletion Screening Primers Design one set of primers internal to ...consists of DMEM supplemented with 2% penicillin/ streptomycin and 1% L-glutamine, which is used for MEL cells...
Showing: 21 - 27 of 27 results